G1383838


Basic Information

Item Value
gene id G1383838
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 49828413 ~ 49885949 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1580609
tgtataagagtcaggtgttgttagttgtctgagaatcatacttaggtagcctgggtttcacttttgagttgtgggtgtttgttttccgtgtgtgtgtttgttgccacacggtactgtttcggtttcgttcgtttcacgtttattgttttgtagttttcagtttatgtctttaaataaacgttatggacacttaccacgctgctcattggtcctccgatccttctcacttctcctcctcagaagagg

Function

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1580609 True 246 lncRNA 0.42 2 49828413 49885949
Loading

Neighbor

gene id symbol gene type direction distance location
tti1 tti1 coding upstream 30396 49789953 ~ 49798017 (+)
tgm2a LOC106566906 coding upstream 42102 49778654 ~ 49786311 (+)
si:dkey-65j6.2 LOC106566904 coding upstream 49979 49745046 ~ 49778434 (+)
LOC110492193 LOC106566911 coding upstream 420951 49394075 ~ 49407462 (+)
LOC110492192 NA coding upstream 438138 49378715 ~ 49390275 (+)
znf341 LOC106566899 coding downstream 53296 49939245 ~ 49951052 (+)
LOC110492206 LOC106566897 coding downstream 110773 49996722 ~ 50015523 (+)
LOC100136219 LOC106566896 coding downstream 235117 50121066 ~ 50210247 (+)
LOC110492207 LOC106566895 coding downstream 356029 50241978 ~ 50311045 (+)
LOC110492209 LOC106566893 coding downstream 438196 50324145 ~ 50326821 (+)
G1383820 LOC106566903 non-coding upstream 24717 49801987 ~ 49803696 (+)
G1383653 LOC106566909 non-coding upstream 288407 49538514 ~ 49540006 (+)
G1383579 NA non-coding upstream 415477 49412484 ~ 49412936 (+)
G1383577 NA non-coding upstream 434584 49393625 ~ 49393829 (+)
G1383571 NA non-coding upstream 450516 49377664 ~ 49377897 (+)
G1383913 LOC106566901 non-coding downstream 50200 49936149 ~ 49936477 (+)
G1383973 NA non-coding downstream 324400 50210349 ~ 50215881 (+)
G1384043 NA non-coding downstream 335435 50221384 ~ 50221756 (+)
LOC110492182 LOC106566913 other upstream 578538 49202107 ~ 49258042 (+)
LOC110492179 NA other upstream 794275 49024001 ~ 49034167 (+)
LOC110492164 mitf other upstream 1515597 48282132 ~ 48331926 (+)
LOC110491080 LOC106572377 other upstream 2799221 47026122 ~ 47029192 (+)
G1379959 LOC106567238 other upstream 2880196 46945257 ~ 46948217 (+)
LOC110492210 LOC106566890 other downstream 604349 50490237 ~ 50796195 (+)
G1384247 NA other downstream 686743 50572692 ~ 50573050 (+)
nphp4 nphp4 other downstream 1395454 51118978 ~ 51310839 (+)
G1386227 ajap1 other downstream 1640064 51526013 ~ 51526813 (+)
G1386254 LOC106566883 other downstream 1674204 51560153 ~ 51560878 (+)

Expression

G1383838 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1383838 Expression in each Bioproject

Bar chart with 12 bars.
G1383838 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network