G1384063



Basic Information


Item Value
gene id G1384063
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 50252012 ~ 50252362 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1580856
atttaaccaggtaggctagttgagaacaagttctcatttacaactgcgacctggccaagataaagcaaagcagtgtgaacagacaacaacacagttacacatggagtaaacaataaacaagtcaataacacagtagtaaaaaaaagaaagtctatatacattgtgtgcaaaaggcatgaggaggtaggcaataaataggccataggagcgaataattacaatttagcagattaacactggagtgataaatgatcagatggtcatgtgcaggtagagatactggtgtgcaaaagagcataaaagtaaataaataaaaacagtatggggatgaggtaggtatattgggtgggc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1580856 True 351 lncRNA 0.38 1 50252012 50252362

Neighbor


gene id symbol gene type direction distance location
LOC100136219 LOC106566896 coding upstream 42815 50121066 ~ 50210247 (+)
LOC110492206 LOC106566897 coding upstream 236489 49996722 ~ 50015523 (+)
znf341 LOC106566899 coding upstream 300960 49939245 ~ 49951052 (+)
tti1 tti1 coding upstream 453995 49789953 ~ 49798017 (+)
tgm2a LOC106566906 coding upstream 465701 49778654 ~ 49786311 (+)
LOC110492209 LOC106566893 coding downstream 71783 50324145 ~ 50326821 (+)
LOC110492210 LOC106566890 coding downstream 237875 50490237 ~ 50796195 (+)
LOC110492909 NA coding downstream 686362 50938724 ~ 50939714 (+)
LOC118939554 NA coding downstream 835739 51088101 ~ 51094492 (+)
c16h1orf174 LOC106566886 coding downstream 857746 51110108 ~ 51113467 (+)
G1384061 NA non-coding upstream 1097 50249583 ~ 50250915 (+)
G1384055 NA non-coding upstream 11419 50240362 ~ 50240593 (+)
G1384050 NA non-coding upstream 20383 50231405 ~ 50231629 (+)
G1384045 NA non-coding upstream 28752 50223043 ~ 50223260 (+)
G1384043 NA non-coding upstream 30256 50221384 ~ 50221756 (+)
G1384076 NA non-coding downstream 42535 50294897 ~ 50295441 (+)
G1384058 NA non-coding downstream 61435 50313797 ~ 50314363 (+)
G1384086 NA non-coding downstream 76993 50329355 ~ 50329678 (+)
G1384092 NA non-coding downstream 83492 50335854 ~ 50336083 (+)
G1384093 NA non-coding downstream 84273 50336635 ~ 50336933 (+)
LOC110492182 LOC106566913 other upstream 1002137 49202107 ~ 49258042 (+)
LOC110492179 NA other upstream 1217874 49024001 ~ 49034167 (+)
LOC110492164 mitf other upstream 1939196 48282132 ~ 48331926 (+)
LOC110491080 LOC106572377 other upstream 3222820 47026122 ~ 47029192 (+)
G1379959 LOC106567238 other upstream 3303795 46945257 ~ 46948217 (+)
G1384247 NA other downstream 320330 50572692 ~ 50573050 (+)
nphp4 nphp4 other downstream 1029041 51118978 ~ 51310839 (+)
G1386227 ajap1 other downstream 1273651 51526013 ~ 51526813 (+)
G1386254 LOC106566883 other downstream 1307791 51560153 ~ 51560878 (+)

Expression


G1384063 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G1384063 Expression in each Bioproject

Bar chart with 19 bars.
G1384063 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 750.
End of interactive chart.

Co-expression Network