G1385592



Basic Information


Item Value
gene id G1385592
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 51015073 ~ 51015415 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1582514
ccacctccacaccccagccctccggtagcagctccccgcaccaggcttcctgtgcgtgtcctcggcccagtaccaccagtgccagcaccacgcatcaggcctacagtgcgcctcgcctgtccagcgctgtcggagccctcctcctcttcagcgctgtcggagtctcccgcctgtttagcgctgtcagagctttccgcctctacagcgctgccggagtctcccgcctgttcggaactgccagtttgcaaggagctgccagtttgcaaggagctgccagtttgcaaggagctgccagtttgcaaggagctgccagtctgcaaggagctgccagtctgtaaggagc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1582514 True 343 lncRNA 0.64 1 51015073 51015415
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110492208 LOC106566894 coding downstream 696300 50314916 ~ 50318773 (-)
itchb LOC106566898 coding downstream 1043780 49950665 ~ 49971293 (-)
e2f1 LOC106566901 coding downstream 1076185 49933079 ~ 49938888 (-)
LOC110491088 LOC106566900 coding downstream 1081323 49927464 ~ 49933750 (-)
LOC110492202 LOC106566902 coding downstream 1134251 49840098 ~ 49880822 (-)
mad2l2 mad2l2 coding upstream 6041 51021456 ~ 51031919 (-)
LOC110491089 lrrc47 coding upstream 25708 51041123 ~ 51043794 (-)
LOC110491090 fam57b coding upstream 61363 51076778 ~ 51077359 (-)
LOC110492214 LOC106566770 coding upstream 86368 51101783 ~ 51103933 (-)
dffb LOC106566885 coding upstream 98176 51113403 ~ 51117850 (-)
G1385591 NA non-coding downstream 114 51014722 ~ 51014959 (-)
G1385590 NA non-coding downstream 1295 51013544 ~ 51013778 (-)
G1385587 NA non-coding downstream 5024 51009812 ~ 51010049 (-)
G1385450 NA non-coding downstream 94895 50919882 ~ 50920178 (-)
G1385441 NA non-coding downstream 105192 50909682 ~ 50909881 (-)
G1385634 NA non-coding upstream 32651 51048066 ~ 51048380 (-)
G1385665 NA non-coding upstream 56451 51071866 ~ 51072238 (-)
G1386030 NA non-coding upstream 290079 51305494 ~ 51340532 (-)
G1384875 NA other downstream 949256 50064821 ~ 50065817 (-)
LOC110491086 LOC106566907 other downstream 1295534 49576512 ~ 49719539 (-)
LOC110492187 LOC106936674 other downstream 1818747 49179653 ~ 49196706 (-)
G1382894 mitf other downstream 2702115 48282213 ~ 48312958 (-)
G1382721 NA other downstream 3068851 47943379 ~ 47946222 (-)
G1385645 NA other upstream 40216 51055631 ~ 51056061 (-)
G1385888 NA other upstream 75230 51090645 ~ 51128648 (-)
LOC110492226 LOC106572002 other upstream 967719 51978399 ~ 51990025 (-)
spen LOC106566857 other upstream 1403461 52379551 ~ 52428869 (-)

Expression


G1385592 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1385592 Expression in each Bioproject

Bar chart with 17 bars.
G1385592 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network