G1385645



Basic Information


Item Value
gene id G1385645
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 51055631 ~ 51056061 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1582569
gcaagatctcaccccgtggggtcaaaatgatcacaagaacggtgagcaaaaatcccagaaccacatggggggacctagtgaatgacctgcagagagctgggaccaaagtaacaaagcctaccatcagtaacacactacgccaccagggactcaaatcctgcattgccagacgtgtccccctgcttaagccagtacatgtccaggcctgtctgaagtttgctagagagcatttggatgatccagaagaagattgggagaatgtcatatggtcagatgaatccaaaatagactcgtcatgtttggaggacaaagaatgctgagttgcatccaaagaacaccatacctactgtgaagcatgggggtggaaacatcatgcgttggggctgtttttctgcaaagggaccaggacgactgatccatgtaaaggaaag

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1582569 True 431 TUCP 0.48 1 51055631 51056061
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110491089 lrrc47 coding downstream 11837 51041123 ~ 51043794 (-)
mad2l2 mad2l2 coding downstream 23712 51021456 ~ 51031919 (-)
LOC110492208 LOC106566894 coding downstream 736858 50314916 ~ 50318773 (-)
itchb LOC106566898 coding downstream 1084338 49950665 ~ 49971293 (-)
e2f1 LOC106566901 coding downstream 1116743 49933079 ~ 49938888 (-)
LOC110491090 fam57b coding upstream 20717 51076778 ~ 51077359 (-)
LOC110492214 LOC106566770 coding upstream 45722 51101783 ~ 51103933 (-)
dffb LOC106566885 coding upstream 57530 51113403 ~ 51117850 (-)
LOC110492220 LOC106566883 coding upstream 466288 51522349 ~ 51603970 (-)
LOC110491091 LOC106566924 coding upstream 634822 51690883 ~ 51717957 (-)
G1385634 NA non-coding downstream 7251 51048066 ~ 51048380 (-)
G1385592 NA non-coding downstream 40216 51015073 ~ 51015415 (-)
G1385591 NA non-coding downstream 40672 51014722 ~ 51014959 (-)
G1385665 NA non-coding upstream 15805 51071866 ~ 51072238 (-)
G1386030 NA non-coding upstream 249433 51305494 ~ 51340532 (-)
G1386059 NA non-coding upstream 305304 51361365 ~ 51362050 (-)
G1386060 NA non-coding upstream 320651 51376712 ~ 51384868 (-)
G1386064 NA non-coding upstream 330165 51386226 ~ 51386542 (-)
G1384875 NA other downstream 989814 50064821 ~ 50065817 (-)
LOC110491086 LOC106566907 other downstream 1336092 49576512 ~ 49719539 (-)
LOC110492187 LOC106936674 other downstream 1859305 49179653 ~ 49196706 (-)
G1382894 mitf other downstream 2742673 48282213 ~ 48312958 (-)
G1382721 NA other downstream 3109409 47943379 ~ 47946222 (-)
G1385888 NA other upstream 34584 51090645 ~ 51128648 (-)
LOC110492226 LOC106572002 other upstream 927073 51978399 ~ 51990025 (-)
spen LOC106566857 other upstream 1362815 52379551 ~ 52428869 (-)
LOC110492250 LOC106566852 other upstream 1515649 52566433 ~ 52577143 (-)

Expression


G1385645 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G1385645 Expression in each Bioproject

Bar chart with 20 bars.
G1385645 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.

Co-expression Network