G1386144



Basic Information


Item Value
gene id G1386144
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 51449437 ~ 51449665 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1583108
gtatttatatagcccttcttacatcagctgatatctcaaagtgctgtacagaaacccagcctaaaaccccaaacagcaagcaatgcaggtgtagaagcgcggtggctaggaaaaactccctagaaaggccagaacctaggaagaaacctagagaggaaccagtctatgaggggaggccagtcctcttctggctgtgctaggtggagattataacagaacatggccaaga

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1583108 True 229 lncRNA 0.48 1 51449437 51449665
Loading

Neighbor


gene id symbol gene type direction distance location
dffb LOC106566885 coding downstream 331587 51113403 ~ 51117850 (-)
LOC110492214 LOC106566770 coding downstream 345504 51101783 ~ 51103933 (-)
LOC110491090 fam57b coding downstream 372078 51076778 ~ 51077359 (-)
LOC110491089 lrrc47 coding downstream 405643 51041123 ~ 51043794 (-)
mad2l2 mad2l2 coding downstream 417518 51021456 ~ 51031919 (-)
LOC110492220 LOC106566883 coding upstream 72684 51522349 ~ 51603970 (-)
LOC110491091 LOC106566924 coding upstream 241218 51690883 ~ 51717957 (-)
LOC110492221 LOC106566882 coding upstream 272305 51721970 ~ 51738292 (-)
LOC110492226 LOC106572002 coding upstream 530949 51978399 ~ 51990025 (-)
LOC110492229 LOC106566874 coding upstream 548893 51998558 ~ 52069366 (-)
G1386077 NA non-coding downstream 49222 51399976 ~ 51400215 (-)
G1386076 NA non-coding downstream 51481 51397691 ~ 51397956 (-)
G1386069 NA non-coding downstream 57768 51391439 ~ 51391669 (-)
G1386067 NA non-coding downstream 58886 51390276 ~ 51390551 (-)
G1386064 NA non-coding downstream 62895 51386226 ~ 51386542 (-)
G1386146 NA non-coding upstream 837 51450502 ~ 51450742 (-)
G1386157 NA non-coding upstream 9077 51458742 ~ 51458950 (-)
G1386166 NA non-coding upstream 15723 51465388 ~ 51465592 (-)
G1386218 NA non-coding upstream 60078 51509743 ~ 51509970 (-)
G1386287 NA non-coding upstream 66970 51516635 ~ 51521317 (-)
G1385888 NA other downstream 320789 51090645 ~ 51128648 (-)
G1385645 NA other downstream 393376 51055631 ~ 51056061 (-)
G1384875 NA other downstream 1383620 50064821 ~ 50065817 (-)
LOC110491086 LOC106566907 other downstream 1729898 49576512 ~ 49719539 (-)
spen LOC106566857 other upstream 969211 52379551 ~ 52428869 (-)
LOC110492250 LOC106566852 other upstream 1122045 52566433 ~ 52577143 (-)
G1388236 NA other upstream 1582267 53031932 ~ 53032921 (-)
LOC110492299 LOC106566805 other upstream 2280672 53730164 ~ 53757019 (-)

Expression


G1386144 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1386144 Expression in each Bioproject

Bar chart with 14 bars.
G1386144 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 50.
End of interactive chart.

Co-expression Network