G1389472 (acss2)



Basic Information


Item Value
gene id G1389472
gene name acss2
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 54112674 ~ 54114811 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1586904
TTCATGGGCGTGGCAGCAGGTAGAGGAGTCAACACGTGGCCACCGGTCTCAGTCTGCCAGAAGGTGTCGACCACGGGGCACCTCTTCTCCCCCACCACGCTGTAGTACCACTGCCACGCCTCCGGGTTGATGGGCTCCCCCACCGTCCCCAGCACCTTCAGAGAATCCCGCTTGTACTTCTGGACGGGCTCGCTCCCATACTTCATGAGAAGGCGGATGGCTGTGGGCGCCGTGTAGAACTTGGTGACTTGGTACTTGTCGACTATCTCCCACATGCGGCTGACATCCGGATAGGTGGGCAGACCCTCGAACTGAACATGTATCAAATTCACATCAAAACCGAGCCAGAGGCAGATGGTGTAAACAACCTCATGATCATAACCTAAGTCATCATTAGCTGTCTGAACTACAGGAGGAAGTAG
>TU1586905
TTCATGGGCGTGGCAGCAGGTAGAGGAGTCAACACGTGGCCACCGGTCTCAGTCTGCCAGAAGGTGTCGACCACGGGGCACCTCTTCTCCCCCACCACGCTGTAGTACCACTGCCACGCCTCCGGGTTGATGGGCTCCCCCACCGTCCCCAGCACCTTCAGAGAATCCCGCTTGTACCTGACACACACACGGAGGGAAAGGGTTAACAGAGACCCCCATAGCCTCAGACAAAAGGACgaaaccaaaacatgcagacaTTTGccaacacac

Function


symbol description
acss2 Predicted to enable CoA-ligase activity and adenyl ribonucleotide binding activity. Predicted to act upstream of or within acetyl-CoA biosynthetic process from acetate. Human ortholog(s) of this gene implicated in orofacial cleft. Orthologous to human ACSS2 (acyl-CoA synthetase short chain family member 2).

NR:

description
PREDICTED: acetyl-coenzyme A synthetase, cytoplasmic-like, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1586904 False 422 lncRNA 0.56 3 54112674 54114811
TU1586905 True 270 lncRNA 0.59 2 54113925 54114811

Neighbor


gene id symbol gene type direction distance location
commd7 comd7 coding downstream 144539 53956911 ~ 53968135 (-)
LOC110491103 LOC106566803 coding downstream 193327 53776875 ~ 53919347 (-)
LOC110492300 LOC106566804 coding downstream 336473 53758360 ~ 53776201 (-)
LOC110492299 LOC106566805 coding downstream 355655 53730164 ~ 53757019 (-)
LOC110491101 LOC106566920 coding downstream 384701 53711870 ~ 53727973 (-)
LOC110491105 LOC106566796 coding upstream 52569 54163558 ~ 54236936 (-)
LOC110492306 LOC106566792 coding upstream 165534 54280345 ~ 54456016 (-)
LOC118936330 NA coding upstream 520574 54635385 ~ 54635876 (-)
LOC110491107 NA coding upstream 524660 54639471 ~ 54640714 (-)
si:dkey-20d21.12 LOC106566776 coding upstream 841051 54946478 ~ 54957989 (-)
G1389512 NA non-coding downstream 16727 54095680 ~ 54095947 (-)
G1389509 NA non-coding downstream 21857 54090582 ~ 54090817 (-)
G1389506 NA non-coding downstream 25405 54087052 ~ 54087269 (-)
G1389471 mapre1 non-coding downstream 34699 54073699 ~ 54077975 (-)
G1389496 NA non-coding downstream 44360 54068108 ~ 54068314 (-)
G1389474 NA non-coding upstream 1652 54116463 ~ 54140078 (-)
G1389533 NA non-coding upstream 26405 54141216 ~ 54141627 (-)
G1389537 NA non-coding upstream 29996 54144807 ~ 54145085 (-)
G1389582 NA non-coding upstream 116675 54231486 ~ 54232349 (-)
G1388236 NA other downstream 1079753 53031932 ~ 53032921 (-)
LOC110492250 LOC106566852 other downstream 1540367 52566433 ~ 52577143 (-)
spen LOC106566857 other downstream 1683915 52379551 ~ 52428869 (-)
LOC110492226 LOC106572002 other downstream 2122679 51978399 ~ 51990025 (-)
G1389763 NA other upstream 429917 54544728 ~ 54545243 (-)
G1390030 ifrd2 other upstream 870007 54984818 ~ 54986263 (-)
LOC110492352 nua4l other upstream 1709348 55824155 ~ 55826646 (-)
G1391586 NA other upstream 1949692 56064503 ~ 56064862 (-)
G1391624 NA other upstream 2110603 56225414 ~ 56226061 (-)

Expression


G1389472(acss2) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1389472(acss2) Expression in each Bioproject

Bar chart with 15 bars.
G1389472(acss2) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network