G1389537



Basic Information


Item Value
gene id G1389537
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 54144807 ~ 54145085 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1586973
aggccaaggtatgtatagttttttgtgtgctctacggcaacggtgtctagatggaatttgtatttgtggtcctggcaactggaccttttttggaacaccattatttttgtcttactgagatttactgtcagggcccaggtctgacagaatctgtgcagaagatctaggtgctgctgtaggccctccttgttttgggacagaagcaccagatcatcagcaaacagtagacgtttgacttcagattctagtaaggtcaggccgggtgctgcagactgttct

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1586973 True 279 lncRNA 0.46 1 54144807 54145085
Loading

Neighbor


gene id symbol gene type direction distance location
commd7 comd7 coding downstream 176672 53956911 ~ 53968135 (-)
LOC110491103 LOC106566803 coding downstream 225460 53776875 ~ 53919347 (-)
LOC110492300 LOC106566804 coding downstream 368606 53758360 ~ 53776201 (-)
LOC110492299 LOC106566805 coding downstream 387788 53730164 ~ 53757019 (-)
LOC110491101 LOC106566920 coding downstream 416834 53711870 ~ 53727973 (-)
LOC110491105 LOC106566796 coding upstream 22295 54163558 ~ 54236936 (-)
LOC110492306 LOC106566792 coding upstream 135260 54280345 ~ 54456016 (-)
LOC118936330 NA coding upstream 490300 54635385 ~ 54635876 (-)
LOC110491107 NA coding upstream 494386 54639471 ~ 54640714 (-)
si:dkey-20d21.12 LOC106566776 coding upstream 810777 54946478 ~ 54957989 (-)
G1389533 NA non-coding downstream 3180 54141216 ~ 54141627 (-)
G1389474 NA non-coding downstream 4729 54116463 ~ 54140078 (-)
G1389472 acss2 non-coding downstream 29996 54112674 ~ 54114811 (-)
G1389512 NA non-coding downstream 48860 54095680 ~ 54095947 (-)
G1389509 NA non-coding downstream 53990 54090582 ~ 54090817 (-)
G1389582 NA non-coding upstream 86401 54231486 ~ 54232349 (-)
G1389598 NA non-coding upstream 118519 54263604 ~ 54264208 (-)
G1389621 NA non-coding upstream 168999 54314084 ~ 54314284 (-)
G1388236 NA other downstream 1111886 53031932 ~ 53032921 (-)
LOC110492250 LOC106566852 other downstream 1572500 52566433 ~ 52577143 (-)
spen LOC106566857 other downstream 1716048 52379551 ~ 52428869 (-)
LOC110492226 LOC106572002 other downstream 2154812 51978399 ~ 51990025 (-)
G1389763 NA other upstream 399643 54544728 ~ 54545243 (-)
G1390030 ifrd2 other upstream 839733 54984818 ~ 54986263 (-)
LOC110492352 nua4l other upstream 1679074 55824155 ~ 55826646 (-)
G1391586 NA other upstream 1919418 56064503 ~ 56064862 (-)
G1391624 NA other upstream 2080329 56225414 ~ 56226061 (-)

Expression


G1389537 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 50.
End of interactive chart.

G1389537 Expression in each Bioproject

Bar chart with 20 bars.
G1389537 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1500.
End of interactive chart.

Co-expression Network