G1389626



Basic Information


Item Value
gene id G1389626
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 54331090 ~ 54331302 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1587081
gagggacagctgctcgggacagagggacagctgctcgggacagagggacagctgctcgggacagagggacagctgctccgggcggaggggctctagcggcccctggctgactggcggcccctggctgactggcggcactggcggcccctggctgactggcggcccctggctgactggcggcactggcggcccctggttgactggcggcgctgg

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1587081 True 213 lncRNA 0.74 1 54331090 54331302

Neighbor


gene id symbol gene type direction distance location
LOC110491105 LOC106566796 coding downstream 94154 54163558 ~ 54236936 (-)
commd7 comd7 coding downstream 362955 53956911 ~ 53968135 (-)
LOC110491103 LOC106566803 coding downstream 411743 53776875 ~ 53919347 (-)
LOC110492300 LOC106566804 coding downstream 554889 53758360 ~ 53776201 (-)
LOC110492299 LOC106566805 coding downstream 574071 53730164 ~ 53757019 (-)
LOC118936330 NA coding upstream 304083 54635385 ~ 54635876 (-)
LOC110491107 NA coding upstream 308169 54639471 ~ 54640714 (-)
si:dkey-20d21.12 LOC106566776 coding upstream 624560 54946478 ~ 54957989 (-)
sema3b LOC106566773 coding upstream 835461 55166763 ~ 55255352 (-)
actr8 actr8 coding upstream 1018842 55350144 ~ 55372295 (-)
G1389621 NA non-coding downstream 16806 54314084 ~ 54314284 (-)
LOC110492306 LOC106566792 non-coding downstream 37593 54280345 ~ 54456016 (-)
G1389598 NA non-coding downstream 66882 54263604 ~ 54264208 (-)
G1389582 NA non-coding downstream 98741 54231486 ~ 54232349 (-)
G1389634 NA non-coding upstream 12843 54344145 ~ 54344470 (-)
G1389636 NA non-coding upstream 14189 54345491 ~ 54345692 (-)
G1389641 NA non-coding upstream 18075 54349377 ~ 54349614 (-)
G1389650 NA non-coding upstream 36642 54367944 ~ 54368155 (-)
G1389656 NA non-coding upstream 43539 54374841 ~ 54375072 (-)
G1388236 NA other downstream 1298169 53031932 ~ 53032921 (-)
LOC110492250 LOC106566852 other downstream 1758783 52566433 ~ 52577143 (-)
spen LOC106566857 other downstream 1902331 52379551 ~ 52428869 (-)
LOC110492226 LOC106572002 other downstream 2341095 51978399 ~ 51990025 (-)
G1389763 NA other upstream 213426 54544728 ~ 54545243 (-)
G1390030 ifrd2 other upstream 653516 54984818 ~ 54986263 (-)
LOC110492352 nua4l other upstream 1492857 55824155 ~ 55826646 (-)
G1391586 NA other upstream 1733201 56064503 ~ 56064862 (-)
G1391624 NA other upstream 1894112 56225414 ~ 56226061 (-)

Expression


G1389626 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G1389626 Expression in each Bioproject

Bar chart with 14 bars.
G1389626 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 125.
End of interactive chart.

Co-expression Network