G1390030 (ifrd2)


Basic Information

Item Value
gene id G1390030
gene name ifrd2
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 54984818 ~ 54986263 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1587517
CTAGCAGCACAGTGAGGCGGGAGGCGGGGCAGAGGGTGACGAGTAGAGCCCAGGCGTGCAGGGCGGCGCTGTGGAGCCCAGGGGTACCGGCCTTGGGGGTGGGCAGGGTGCCCTCAAAGTTGGGGTACGACGTGGTGAACACACTTTCCAGGTGACTCATGGATTTGACCAAGTCCTCTCCATCTTCCGCAGCAGAAACATAGCAGCACATACCCAGAGCACTGGCACAGCTCTGGCGGGCGGCCACACTGGCACAGCCGTCAATCATGATGGCGCTGAGGACGGGTCGAAGGATCTTGAAGCCCTCCTCGCTCTCGTCCCCCCCGCCCAGCTGCACACACAGCTGGGCACACACTGTGGCCGCTGCAGCCTGCTCCTCTCCACCACCCTTGCGCAGGCTCCTCTCCAGGCAGTCGCTGATGGTGAGGCGTCTCTCTGTCAGGAAGTCACAGAGCAGCCTGGATGAGAAGGCCCCTCTCAGAGACTCCAGGGCTGCCAGGCGTGTCTTTGCACTCTTGTCCATCAGGTTGTCTATGCATTGTTTCAGCTTGTCCTCGGTCTCTTCCTGGGCAGTCTGTTCATCTAGTGGCTCACCTG

Function

symbol description
ifrd2 Is expressed in several structures, including alar plate midbrain region; digestive system; midbrain; pectoral fin bud; and segmental plate. Orthologous to human IFRD2 (interferon related developmental regulator 2).

NR:

description
interferon-related developmental regulator 2-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1587517 True 597 TUCP 0.62 5 54984818 54986263
Loading

Neighbor

gene id symbol gene type direction distance location
si:dkey-20d21.12 LOC106566776 coding downstream 26829 54946478 ~ 54957989 (-)
LOC110491107 NA coding downstream 344104 54639471 ~ 54640714 (-)
LOC118936330 NA coding downstream 348942 54635385 ~ 54635876 (-)
LOC110492306 LOC106566792 coding downstream 528802 54280345 ~ 54456016 (-)
LOC110491105 LOC106566796 coding downstream 747882 54163558 ~ 54236936 (-)
sema3b LOC106566773 coding upstream 180500 55166763 ~ 55255352 (-)
actr8 actr8 coding upstream 363881 55350144 ~ 55372295 (-)
LOC110492331 LOC106566684 coding upstream 389472 55375735 ~ 55383021 (-)
LOC110491111 LOC106566685 coding upstream 411374 55397637 ~ 55517109 (-)
LOC110492334 dkga coding upstream 582114 55568377 ~ 55582222 (-)
G1390017 NA non-coding downstream 14524 54970033 ~ 54970294 (-)
G1389965 amt non-coding downstream 17755 54966441 ~ 54967063 (-)
G1389960 NA non-coding downstream 40968 54942907 ~ 54943850 (-)
G1389967 LOC106572271 non-coding downstream 45177 54937684 ~ 54939641 (-)
G1390199 NA non-coding upstream 86101 55072364 ~ 55072714 (-)
G1390240 NA non-coding upstream 153817 55140080 ~ 55140423 (-)
G1390241 NA non-coding upstream 155945 55142208 ~ 55142489 (-)
G1390242 NA non-coding upstream 156646 55142909 ~ 55143242 (-)
G1390252 NA non-coding upstream 174105 55160368 ~ 55160650 (-)
G1389763 NA other downstream 439575 54544728 ~ 54545243 (-)
LOC110492299 LOC106566805 other downstream 1251903 53730164 ~ 53757019 (-)
G1388236 NA other downstream 1951897 53031932 ~ 53032921 (-)
LOC110492250 LOC106566852 other downstream 2412511 52566433 ~ 52577143 (-)
spen LOC106566857 other downstream 2556059 52379551 ~ 52428869 (-)
LOC110492352 nua4l other upstream 837896 55824155 ~ 55826646 (-)
G1391586 NA other upstream 1078240 56064503 ~ 56064862 (-)
G1391624 NA other upstream 1239151 56225414 ~ 56226061 (-)
LOC110492371 adcy6 other upstream 1294789 56240763 ~ 56293503 (-)
G1391796 LOC100286403 other upstream 1438009 56424272 ~ 56437279 (-)

Expression

G1390030(ifrd2) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.4.
End of interactive chart.

G1390030(ifrd2) Expression in each Bioproject

Bar chart with 9 bars.
G1390030(ifrd2) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 12.
End of interactive chart.

Co-expression Network