G1390371



Basic Information


Item Value
gene id G1390371
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 55345795 ~ 55346061 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1587907
gtcaaggatcatatcacctccaccctaccggtcaccctagacccacttcaatttgctttccgccccaataggtccacagacgatgtaatcgccatcacactgcgctatcccatctggacaagaggaatacctatgtatgaatgctgttcattgactacagctcagcattcaacaccatagtaccctccaaactcatcattaagcttgagaccctgggtctcgacccgccctgtgcaactgggtcttggaaaacaacatctccactcc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1587907 True 267 lncRNA 0.50 1 55345795 55346061
Loading

Neighbor


gene id symbol gene type direction distance location
sema3b LOC106566773 coding downstream 90443 55166763 ~ 55255352 (-)
si:dkey-20d21.12 LOC106566776 coding downstream 387806 54946478 ~ 54957989 (-)
LOC110491107 NA coding downstream 705081 54639471 ~ 54640714 (-)
LOC118936330 NA coding downstream 709919 54635385 ~ 54635876 (-)
LOC110492306 LOC106566792 coding downstream 889779 54280345 ~ 54456016 (-)
actr8 actr8 coding upstream 4083 55350144 ~ 55372295 (-)
LOC110492331 LOC106566684 coding upstream 29674 55375735 ~ 55383021 (-)
LOC110491111 LOC106566685 coding upstream 51576 55397637 ~ 55517109 (-)
LOC110492334 dkga coding upstream 222316 55568377 ~ 55582222 (-)
LOC110492337 sgk2 coding upstream 249508 55595569 ~ 55607324 (-)
G1390350 NA non-coding downstream 27820 55317667 ~ 55317975 (-)
G1390346 NA non-coding downstream 28936 55316600 ~ 55316859 (-)
G1390312 NA non-coding downstream 56814 55288711 ~ 55288981 (-)
G1390303 NA non-coding downstream 69993 55275581 ~ 55275802 (-)
G1390301 NA non-coding downstream 75364 55270191 ~ 55270431 (-)
G1390645 NA non-coding upstream 46629 55392690 ~ 55429824 (-)
G1390692 LOC106597055 non-coding upstream 115990 55462051 ~ 55462661 (-)
G1390752 NA non-coding upstream 183646 55529707 ~ 55530272 (-)
G1390754 LOC106566686 non-coding upstream 187142 55533203 ~ 55533715 (-)
G1390756 NA non-coding upstream 190678 55536739 ~ 55536983 (-)
G1390030 ifrd2 other downstream 359532 54984818 ~ 54986263 (-)
G1389763 NA other downstream 800552 54544728 ~ 54545243 (-)
LOC110492299 LOC106566805 other downstream 1612880 53730164 ~ 53757019 (-)
G1388236 NA other downstream 2312874 53031932 ~ 53032921 (-)
LOC110492250 LOC106566852 other downstream 2773488 52566433 ~ 52577143 (-)
LOC110492352 nua4l other upstream 478098 55824155 ~ 55826646 (-)
G1391586 NA other upstream 718442 56064503 ~ 56064862 (-)
G1391624 NA other upstream 879353 56225414 ~ 56226061 (-)
LOC110492371 adcy6 other upstream 934991 56240763 ~ 56293503 (-)
G1391796 LOC100286403 other upstream 1078211 56424272 ~ 56437279 (-)

Expression


G1390371 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G1390371 Expression in each Bioproject

Bar chart with 17 bars.
G1390371 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network