G1390376 (actr8)



Basic Information


Item Value
gene id G1390376
gene name actr8
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 55351200 ~ 55351729 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1587913
AGCAATCGATGCTGTGTAGGATGGCTTTGTCCAAGCCTAGCGCTTTGCCCTCAAACTGGGTCATGGCAGTCTTCCTGGAGAGGAGTGCTGAGGGAGGCTCCTCCATCTCTGCTCCTCCCATCAGGCAGTCGTTCTGGGAGTGTCCCAGCTCCACATCCTGGCCATGGGCACCACCTCCACGTTCTGAGGGGTCCCCACCCTGGCTGCTCAACTCCCCCTCGAACCCAGGCGGCTTGGGAAGGGATTTACGCTCTGCTGAGGCTTTAGAGGACTGGTCCTGCTTGCTCTGGGTTCCCAGTAGGTAGTGTTCATCATGTGGGTCCTCTGGGTCACCCTGAGATCTGTGCTGCAAGGAGGTCATCTTCTGGCCCACTATTCCAAACGTGGTGGGGTAGAACAAGGC

Function


symbol description
actr8 Predicted to enable ATP binding activity. Predicted to be involved in ATP-dependent chromatin remodeling; double-strand break repair; and regulation of transcription, DNA-templated. Predicted to act upstream of or within DNA metabolic process; cell division; and chromatin remodeling. Predicted to be located in chromosome and nucleus. Predicted to be part of Ino80 complex. Orthologous to human ACTR8 (actin related protein 8).

NR:

description
actin-related protein 8

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1587913 True 403 TUCP 0.58 2 55351200 55351729

Neighbor


gene id symbol gene type direction distance location
sema3bl sema3g coding upstream 212097 55072237 ~ 55139103 (+)
LOC110492913 NA coding upstream 358851 54989353 ~ 54992349 (+)
ifrd2 ifrd2 coding upstream 362502 54971324 ~ 55032425 (+)
LOC110492324 LOC106566775 coding upstream 382306 54958795 ~ 54968894 (+)
hyal3 LOC106566776 coding upstream 395473 54944723 ~ 54955727 (+)
LOC110492332 LOC106566686 coding downstream 165176 55516905 ~ 55535738 (+)
LOC110492333 LOC106566687 coding downstream 187577 55539306 ~ 55564300 (+)
LOC110492335 catsperd coding downstream 230388 55582117 ~ 55595490 (+)
LOC110492343 LOC106566691 coding downstream 302271 55654000 ~ 55661738 (+)
LOC110491113 LOC106566694 coding downstream 357538 55709267 ~ 55740977 (+)
G1390351 NA non-coding upstream 32513 55318477 ~ 55318687 (+)
G1390349 NA non-coding upstream 33124 55317827 ~ 55318076 (+)
G1390339 NA non-coding upstream 37619 55313295 ~ 55313581 (+)
G1390336 NA non-coding upstream 39788 55311165 ~ 55311412 (+)
G1390317 NA non-coding upstream 57128 55293752 ~ 55294072 (+)
G1390397 NA non-coding downstream 31453 55383182 ~ 55383419 (+)
G1390402 NA non-coding downstream 48132 55399861 ~ 55403953 (+)
G1390439 NA non-coding downstream 175420 55527149 ~ 55527530 (+)
G1390438 NA non-coding downstream 185372 55537101 ~ 55537705 (+)
LOC110492320 LOC106566780 other upstream 568852 54769016 ~ 54821566 (+)
G1388919 LOC106566792 other upstream 1044292 54306450 ~ 54306908 (+)
G1388917 LOC106566792 other upstream 1049042 54299174 ~ 54302158 (+)
G1388806 NA other upstream 1121339 54163086 ~ 54229861 (+)
LOC110492303 LOC106566801 other upstream 1301458 54045935 ~ 54061849 (+)
G1390386 LOC106566684 other downstream 12739 55364468 ~ 55381360 (+)
G1390473 NA other downstream 176864 55528593 ~ 55529648 (+)
G1390508 NA other downstream 276965 55628694 ~ 55632838 (+)
G1390527 NA other downstream 288293 55640022 ~ 55640299 (+)
G1390616 LOC106566696 other downstream 441295 55793024 ~ 55823192 (+)

Expression


G1390376(actr8) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1390376(actr8) Expression in each Bioproject

Bar chart with 9 bars.
G1390376(actr8) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 50.
End of interactive chart.

Co-expression Network