G1390692 (LOC106597055)



Basic Information


Item Value
gene id G1390692
gene name LOC106597055
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 55462051 ~ 55462661 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1588277
agtagagctgtgttgtgatgggccgggtctagtagagctgtgttgtgatgggccgggtctagtagagctgtgttgtgatgggccgggtctagtagagctgtgttgtgatgggccgggtctagtagagctgtgttgtgatgggccaggtctagtagagctgtgttgggatgggctgggtctagtagagctgtgttgtgaagggccgggtctagtagagctgtgttgtgatgggccaggtctagtagagctgtgctgtgttgggcctggtctagtagagctgtgctgtaataagtcatgtctggctcttttctcctcgggatggtggaggtactgttgtttcagaaggtggggcgggggacctttgttgctggggtgatgggtgtgtgggtccctgccaagtgttgcatcttttaggtccttggcaaaggttctgatactgtcctgatcaagatgtatattatcatataagtgttgacatgtcagagtggggtggtgagccgttctgacgttgagcagtgagg

Function


NR:

description
PREDICTED: uncharacterized protein LOC106597055, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1588277 True 521 lncRNA 0.53 2 55462051 55462661
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110492331 LOC106566684 coding downstream 79030 55375735 ~ 55383021 (-)
actr8 actr8 coding downstream 89756 55350144 ~ 55372295 (-)
sema3b LOC106566773 coding downstream 206699 55166763 ~ 55255352 (-)
si:dkey-20d21.12 LOC106566776 coding downstream 504062 54946478 ~ 54957989 (-)
LOC110491107 NA coding downstream 821337 54639471 ~ 54640714 (-)
LOC110492334 dkga coding upstream 105716 55568377 ~ 55582222 (-)
LOC110492337 sgk2 coding upstream 132908 55595569 ~ 55607324 (-)
LOC110492338 LOC106566690 coding upstream 146526 55609187 ~ 55626735 (-)
LOC110492341 LOC106571981 coding upstream 164254 55626915 ~ 55632905 (-)
LOC110492339 rae1 coding upstream 171153 55633814 ~ 55638471 (-)
G1390645 NA non-coding downstream 32227 55392690 ~ 55429824 (-)
G1390371 NA non-coding downstream 115990 55345795 ~ 55346061 (-)
G1390350 NA non-coding downstream 144076 55317667 ~ 55317975 (-)
G1390346 NA non-coding downstream 145192 55316600 ~ 55316859 (-)
G1390312 NA non-coding downstream 173070 55288711 ~ 55288981 (-)
G1390752 NA non-coding upstream 67046 55529707 ~ 55530272 (-)
G1390754 LOC106566686 non-coding upstream 70542 55533203 ~ 55533715 (-)
G1390756 NA non-coding upstream 74078 55536739 ~ 55536983 (-)
G1390755 NA non-coding upstream 74530 55537191 ~ 55537704 (-)
G1390744 NA non-coding upstream 101869 55564530 ~ 55566248 (-)
G1390030 ifrd2 other downstream 475788 54984818 ~ 54986263 (-)
G1389763 NA other downstream 916808 54544728 ~ 54545243 (-)
LOC110492299 LOC106566805 other downstream 1729136 53730164 ~ 53757019 (-)
G1388236 NA other downstream 2429130 53031932 ~ 53032921 (-)
LOC110492250 LOC106566852 other downstream 2889744 52566433 ~ 52577143 (-)
LOC110492352 nua4l other upstream 361498 55824155 ~ 55826646 (-)
G1391586 NA other upstream 601842 56064503 ~ 56064862 (-)
G1391624 NA other upstream 762753 56225414 ~ 56226061 (-)
LOC110492371 adcy6 other upstream 818391 56240763 ~ 56293503 (-)
G1391796 LOC100286403 other upstream 961611 56424272 ~ 56437279 (-)

Expression


G1390692(LOC106597055) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1390692(LOC106597055) Expression in each Bioproject

Bar chart with 20 bars.
G1390692(LOC106597055) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network