G1390527



Basic Information


Item Value
gene id G1390527
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 55640022 ~ 55640299 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1588081
cacaccaaacatgtggaagaaggtgctctggtcagatgaaaccaaaattgaactttttggcaacaatgcaaagcgttatgtttggcgtaaaagcaacacagctgaacacaccatccccactgtcaaacatggtggtggcagcatcatggtttgggcctgcttttcttcagcagggacagggaagatggttaaaattgatgggaagatggatggagccaaatacaggaccattctggaagaaaacctgatggagtctgcaaaacacctgagactgggac

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1588081 True 278 TUCP 0.46 1 55640022 55640299

Neighbor


gene id symbol gene type direction distance location
LOC110492335 catsperd coding upstream 44532 55582117 ~ 55595490 (+)
LOC110492333 LOC106566687 coding upstream 75722 55539306 ~ 55564300 (+)
LOC110492332 LOC106566686 coding upstream 104284 55516905 ~ 55535738 (+)
sema3bl sema3g coding upstream 500919 55072237 ~ 55139103 (+)
LOC110492913 NA coding upstream 647673 54989353 ~ 54992349 (+)
LOC110492343 LOC106566691 coding downstream 13701 55654000 ~ 55661738 (+)
LOC110491113 LOC106566694 coding downstream 68968 55709267 ~ 55740977 (+)
LOC110492345 prelid3b coding downstream 107631 55747930 ~ 55750490 (+)
LOC110492349 LOC106566696 coding downstream 152716 55793015 ~ 55794747 (+)
LOC110492351 NA coding downstream 170933 55811232 ~ 55823631 (+)
G1390518 LOC106566690 non-coding upstream 22010 55617337 ~ 55618012 (+)
G1390499 NA non-coding upstream 60352 55579459 ~ 55579670 (+)
G1390492 dkga non-coding upstream 67849 55570377 ~ 55572173 (+)
G1390480 NA non-coding upstream 72224 55566863 ~ 55567798 (+)
G1390479 NA non-coding upstream 73728 55565560 ~ 55566294 (+)
G1390530 NA non-coding downstream 4873 55645172 ~ 55645435 (+)
G1390561 NA non-coding downstream 57633 55697932 ~ 55698165 (+)
G1390568 NA non-coding downstream 65269 55705568 ~ 55705858 (+)
G1390577 NA non-coding downstream 75846 55716145 ~ 55716370 (+)
G1390579 NA non-coding downstream 77239 55717538 ~ 55718036 (+)
G1390508 NA other upstream 7184 55628694 ~ 55632838 (+)
G1390473 NA other upstream 110374 55528593 ~ 55529648 (+)
G1390386 LOC106566684 other upstream 258662 55364468 ~ 55381360 (+)
G1390376 actr8 other upstream 288293 55351200 ~ 55351729 (+)
LOC110492320 LOC106566780 other upstream 857674 54769016 ~ 54821566 (+)
G1390616 LOC106566696 other downstream 152725 55793024 ~ 55823192 (+)
G1391254 NA other downstream 606216 56246515 ~ 56247620 (+)
LOC118939462 LOC106566730 other downstream 1139762 56779988 ~ 56790929 (+)
G1392601 NA other downstream 1725652 57365951 ~ 57366517 (+)
G1392616 NA other downstream 1756641 57396940 ~ 57397177 (+)

Expression


G1390527 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G1390527 Expression in each Bioproject

Bar chart with 18 bars.
G1390527 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network