G1390818



Basic Information


Item Value
gene id G1390818
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 55667128 ~ 55667643 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1588407
cattaaggcctgattcacactgtctcctctgaacagttgatgttggaatgtctgttacttgaactctgtgaagcatttatttgggctgcaatttctgaggctggtaagtctaatgaacttatcctctgcagccgaggtaactctgggtcttccattcctgtggcggtcctaatgagagccagtttcatcaaggtgcttgatggtttttgcgactgcacttgaagactttcaaagttcttgaaatattccagattgtctgaccttcatgtcttaaagtaatgatggactgttgtttctctttgcttatttgagctgttctcgccataatatggacttttatcaaatagggctatcttctgtataccaccccaaccttgtcacaacacaactgattggctcaaacgctttacgaaggaaattccacaaattaacttttaacaaggcacacctgttaattgaaatgcattccaggtgactacctcatgaagctggttgagagaatgccaagagtgtgca

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1588407 True 516 lncRNA 0.42 1 55667128 55667643

Neighbor


gene id symbol gene type direction distance location
LOC110492342 LOC106566692 coding downstream 17713 55646145 ~ 55649415 (-)
LOC110492339 rae1 coding downstream 28657 55633814 ~ 55638471 (-)
LOC110492341 LOC106571981 coding downstream 34223 55626915 ~ 55632905 (-)
LOC110492338 LOC106566690 coding downstream 40393 55609187 ~ 55626735 (-)
LOC110492337 sgk2 coding downstream 59804 55595569 ~ 55607324 (-)
LOC100170209 LOC100170209 coding upstream 3821 55671464 ~ 55692812 (-)
LOC110492344 NA coding upstream 74625 55742140 ~ 55745483 (-)
LOC110492346 bpi coding upstream 87487 55755130 ~ 55769029 (-)
LOC110492348 viaat coding upstream 116165 55783808 ~ 55787739 (-)
LOC110492352 nua4l coding upstream 156512 55824155 ~ 55826646 (-)
G1390817 NA non-coding downstream 256 55666507 ~ 55666872 (-)
G1390797 NA non-coding downstream 53161 55602174 ~ 55613967 (-)
G1390777 NA non-coding downstream 86227 55580207 ~ 55580901 (-)
G1390772 NA non-coding downstream 91825 55574956 ~ 55575303 (-)
G1390771 NA non-coding downstream 92320 55574529 ~ 55574808 (-)
G1390841 LOC106613263 non-coding upstream 47599 55715242 ~ 55715658 (-)
G1390845 NA non-coding upstream 51889 55719532 ~ 55719754 (-)
G1390850 NA non-coding upstream 59872 55727515 ~ 55727835 (-)
G1390853 NA non-coding upstream 62063 55729706 ~ 55729927 (-)
G1390854 NA non-coding upstream 63162 55730805 ~ 55731077 (-)
G1390030 ifrd2 other downstream 680865 54984818 ~ 54986263 (-)
G1389763 NA other downstream 1121885 54544728 ~ 54545243 (-)
LOC110492299 LOC106566805 other downstream 1934213 53730164 ~ 53757019 (-)
G1388236 NA other downstream 2634207 53031932 ~ 53032921 (-)
LOC110492250 LOC106566852 other downstream 3094821 52566433 ~ 52577143 (-)
G1391586 NA other upstream 396860 56064503 ~ 56064862 (-)
G1391624 NA other upstream 557771 56225414 ~ 56226061 (-)
LOC110492371 adcy6 other upstream 613409 56240763 ~ 56293503 (-)
G1391796 LOC100286403 other upstream 756629 56424272 ~ 56437279 (-)

Expression


G1390818 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1390818 Expression in each Bioproject

Bar chart with 20 bars.
G1390818 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.

Co-expression Network