G1390873



Basic Information


Item Value
gene id G1390873
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 55776153 ~ 55777082 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1588463
cttccctttcctaataattgctcccacagttgatgtattcaaaccaagctgcttacctattgcagattcagtcttcccagcctggtgcaggtctacaattttgtttctggtgtcctttgacagctctttggtcttggccatagtggagtttggagtgtgactgtttgaggttgtggacatgtgtcttttatactgataacaagttcaaacaggtgccattaatacaggtaacgagtggaggacagaggagcctcttaaagaagttacaggtctgtgagagccagaaatattgcttgtttgtaggtgaccaaatacgtattttccaccataatttgcaaataaattcattacaaatcctacaatgtgattttctggattttttttctcattttgtctgtcatagttgaagtgtacctatgatgaaaatgacaggcctctctcatctttttaagtgggagaacttgcacaattggtggctgactaaatacttttttgccccactgtatatgtatttgtatatgtggcgcagtggttaagggcgctgtactgcagcgccagctgtgccatcagagtcctgggttcgcgcccaggctctgtcgtaaccggccgcgaccgggaggtccgtggggcgacgcacaattggcctagcgtcacccgggttagggagggcttggtcggtaggggtgtccttgtctcatcgcgcaccagcgactcctgtggcgggctgggcgcagtgtacgctagccaaggtggccaggtgcacagtgtttcctccggcgcattggtgcggctggcttccgggttggatgtgcgctgtgttaaagaagcagcggcttggttggttgtgtatcgtaggacgcatgactttcaaccttcgtctctcccgagcccgtacgggagttgtagcgatgagacaagatagtagctact

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1588463 True 930 lncRNA 0.49 1 55776153 55777082

Neighbor


gene id symbol gene type direction distance location
LOC110492346 bpi coding downstream 7124 55755130 ~ 55769029 (-)
LOC110492344 NA coding downstream 30670 55742140 ~ 55745483 (-)
LOC100170209 LOC100170209 coding downstream 83341 55671464 ~ 55692812 (-)
LOC110492342 LOC106566692 coding downstream 126738 55646145 ~ 55649415 (-)
LOC110492339 rae1 coding downstream 137682 55633814 ~ 55638471 (-)
LOC110492348 viaat coding upstream 6726 55783808 ~ 55787739 (-)
LOC110492352 nua4l coding upstream 47073 55824155 ~ 55826646 (-)
LOC110492353 nua4l coding upstream 67603 55844681 ~ 55847496 (-)
LOC110492354 LOC106566769 coding upstream 108301 55885383 ~ 55888359 (-)
LOC110492355 LOC106566701 coding upstream 119104 55896186 ~ 55908040 (-)
G1390863 NA non-coding downstream 28664 55747048 ~ 55747489 (-)
G1390862 NA non-coding downstream 29638 55746277 ~ 55746515 (-)
G1390856 NA non-coding downstream 42780 55733173 ~ 55733373 (-)
G1390855 LOC106566694 non-coding downstream 44663 55731238 ~ 55731490 (-)
G1390877 NA non-coding upstream 4164 55781246 ~ 55781400 (-)
G1390876 NA non-coding upstream 4447 55781529 ~ 55781881 (-)
G1390888 NA non-coding upstream 21135 55798217 ~ 55804675 (-)
G1390893 NA non-coding upstream 34563 55811645 ~ 55813087 (-)
G1390030 ifrd2 other downstream 789890 54984818 ~ 54986263 (-)
G1389763 NA other downstream 1230910 54544728 ~ 54545243 (-)
LOC110492299 LOC106566805 other downstream 2043238 53730164 ~ 53757019 (-)
G1388236 NA other downstream 2743232 53031932 ~ 53032921 (-)
LOC110492250 LOC106566852 other downstream 3203846 52566433 ~ 52577143 (-)
G1391586 NA other upstream 287421 56064503 ~ 56064862 (-)
G1391624 NA other upstream 448332 56225414 ~ 56226061 (-)
LOC110492371 adcy6 other upstream 503970 56240763 ~ 56293503 (-)
G1391796 LOC100286403 other upstream 647190 56424272 ~ 56437279 (-)

Expression


G1390873 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1390873 Expression in each Bioproject

Bar chart with 21 bars.
G1390873 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network