G1391303



Basic Information


Item Value
gene id G1391303
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 56323445 ~ 56323660 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1588940
GATAAAAGGCTATATGTCAACAGGTCTACTCACCTCTACAATGGAAAGCCAGTAGTAGGCTATAACTACTGGCTGTAGGTCAAGTCAAACCTTAAGCTGCTTCACGCAAGGTTTCTCTATTGTAGGACAACAGATTTACTGGCCTTCAATCCCTAAGACATTTGTGTCTTTATTATTGCATTTATGCATATGATTACTTTAGGACTATTTGCACAT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1588940 True 216 lncRNA 0.38 1 56323445 56323660
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110491117 NA coding upstream 947 56310609 ~ 56322498 (+)
LOC118939557 NA coding upstream 83672 56237795 ~ 56239773 (+)
LOC110492370 LOC106566713 coding upstream 117144 56189995 ~ 56206301 (+)
LOC110492366 LOC106566712 coding upstream 134322 56091258 ~ 56189123 (+)
LOC110492364 LOC106566711 coding upstream 248044 56055330 ~ 56075401 (+)
prim1 prim1 coding downstream 76390 56400050 ~ 56412393 (+)
LOC110492373 LOC100286403 coding downstream 100527 56424187 ~ 56437287 (+)
LOC118939611 NA coding downstream 111923 56435583 ~ 56435653 (+)
LOC118939608 NA coding downstream 112936 56436596 ~ 56436669 (+)
LOC118939609 NA coding downstream 113367 56437027 ~ 56437100 (+)
G1391256 NA non-coding upstream 74787 56248365 ~ 56248658 (+)
G1391255 NA non-coding upstream 75250 56247965 ~ 56248195 (+)
G1391254 NA non-coding upstream 75825 56246515 ~ 56247620 (+)
G1391253 NA non-coding upstream 77091 56246083 ~ 56246354 (+)
G1391252 NA non-coding upstream 77428 56245741 ~ 56246017 (+)
G1391307 NA non-coding downstream 6199 56329859 ~ 56330076 (+)
G1391318 NA non-coding downstream 27336 56350996 ~ 56352432 (+)
G1391327 NA non-coding downstream 36967 56360627 ~ 56362061 (+)
G1391370 NA non-coding downstream 99761 56423421 ~ 56423733 (+)
G1391363 NA non-coding downstream 134243 56457903 ~ 56459321 (+)
G1390616 LOC106566696 other upstream 500253 55793024 ~ 55823192 (+)
G1390527 NA other upstream 683146 55640022 ~ 55640299 (+)
G1390508 NA other upstream 690607 55628694 ~ 55632838 (+)
G1390473 NA other upstream 793797 55528593 ~ 55529648 (+)
LOC118939462 LOC106566730 other downstream 456401 56779988 ~ 56790929 (+)
G1392601 NA other downstream 1042291 57365951 ~ 57366517 (+)
G1392616 NA other downstream 1073280 57396940 ~ 57397177 (+)
G1392617 NA other downstream 1077825 57401485 ~ 57402530 (+)
G1393570 LOC106566761 other downstream 2095726 58419386 ~ 58423502 (+)

Expression


G1391303 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.25.
End of interactive chart.

G1391303 Expression in each Bioproject

Bar chart with 8 bars.
G1391303 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 8.
End of interactive chart.

Co-expression Network