G1392046



Basic Information


Item Value
gene id G1392046
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 56870118 ~ 56870322 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1589748
acaataagtgggacacaatcatgaagtggaacgacatttattggatatttcaaacttttttaacaaatcaaaaactgaaaaattgggggtgcaaaattattcagcccctttactttcagtgcagcaaactctctccaggagttcagtgaggatctctgaaggatccaatgttgacctaaatgactaatgatgataaatacaatcc

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1589748 True 205 lncRNA 0.36 1 56870118 56870322

Neighbor


gene id symbol gene type direction distance location
LOC110492385 LOC106566733 coding upstream 39525 56825787 ~ 56830593 (+)
si:ch73-181d5.4 LOC106566730 coding upstream 49673 56790783 ~ 56820445 (+)
LOC118939462 LOC106566730 coding upstream 79189 56779988 ~ 56790929 (+)
LOC118939558 NA coding upstream 95040 56767646 ~ 56775078 (+)
LOC110492382 LOC100195767 coding upstream 107636 56729499 ~ 56762482 (+)
LOC110492387 LOC106566767 coding downstream 34621 56904943 ~ 56907957 (+)
LOC110492389 cdh4 coding downstream 375444 57245766 ~ 57788596 (+)
LOC110492393 lsm14b coding downstream 975688 57846010 ~ 57850014 (+)
LOC110492391 ss18l1 coding downstream 983579 57853901 ~ 57873777 (+)
LOC110492396 y4629 coding downstream 1006127 57876449 ~ 57887706 (+)
G1392042 NA non-coding upstream 791 56869050 ~ 56869327 (+)
G1391577 NA non-coding upstream 15654 56852758 ~ 56854464 (+)
G1391569 NA non-coding upstream 48572 56821237 ~ 56821546 (+)
G1391564 NA non-coding upstream 94067 56775527 ~ 56776051 (+)
G1392048 NA non-coding downstream 780 56871102 ~ 56871326 (+)
G1392060 NA non-coding downstream 9492 56879814 ~ 56880058 (+)
G1392067 NA non-coding downstream 13025 56883347 ~ 56883568 (+)
G1392066 NA non-coding downstream 15421 56885743 ~ 56886406 (+)
G1392088 NA non-coding downstream 25973 56896295 ~ 56896543 (+)
G1391254 NA other upstream 623245 56246515 ~ 56247620 (+)
G1390616 LOC106566696 other upstream 1046926 55793024 ~ 55823192 (+)
G1390527 NA other upstream 1229819 55640022 ~ 55640299 (+)
G1390508 NA other upstream 1237280 55628694 ~ 55632838 (+)
G1392601 NA other downstream 495629 57365951 ~ 57366517 (+)
G1392616 NA other downstream 526618 57396940 ~ 57397177 (+)
G1392617 NA other downstream 531163 57401485 ~ 57402530 (+)
G1393570 LOC106566761 other downstream 1549064 58419386 ~ 58423502 (+)
G1393647 LOC106613431 other downstream 1695814 58566136 ~ 58566794 (+)

Expression


G1392046 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1392046 Expression in each Bioproject

Bar chart with 8 bars.
G1392046 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 125.
End of interactive chart.

Co-expression Network