G1392616



Basic Information


Item Value
gene id G1392616
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 57396940 ~ 57397177 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1590330
atggagaggaacagagaaggaggagagatggagaggaacagagaggaggagagatggagaggaacagagagggacagagagggagaggtaacagagagggaacagagagggagaggtaacagagagggaggagagatggagagaaacagagaggaacagagagggagaggaacagagaaggaggagagatggagaggaacagagaaggaggagatatggagaggaacagagaaggagg

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1590330 True 238 TUCP 0.53 1 57396940 57397177
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110492387 LOC106566767 coding upstream 489206 56904943 ~ 56907957 (+)
LOC110492385 LOC106566733 coding upstream 566347 56825787 ~ 56830593 (+)
si:ch73-181d5.4 LOC106566730 coding upstream 576495 56790783 ~ 56820445 (+)
LOC118939462 LOC106566730 coding upstream 606011 56779988 ~ 56790929 (+)
LOC118939558 NA coding upstream 621862 56767646 ~ 56775078 (+)
LOC110492393 lsm14b coding downstream 448833 57846010 ~ 57850014 (+)
LOC110492391 ss18l1 coding downstream 456724 57853901 ~ 57873777 (+)
LOC110492396 y4629 coding downstream 479272 57876449 ~ 57887706 (+)
LOC118936470 NA coding downstream 557739 57954916 ~ 57964183 (+)
LOC110492402 LOC106566744 coding downstream 643378 58040555 ~ 58088256 (+)
G1392610 NA non-coding upstream 15408 57381282 ~ 57381532 (+)
G1392602 NA non-coding upstream 23987 57372676 ~ 57372953 (+)
G1392600 NA non-coding upstream 31028 57365679 ~ 57365912 (+)
G1392536 NA non-coding upstream 131071 57265611 ~ 57265869 (+)
G1392535 NA non-coding upstream 134084 57262654 ~ 57262856 (+)
G1392619 NA non-coding downstream 8390 57405567 ~ 57405913 (+)
G1392627 NA non-coding downstream 16727 57413904 ~ 57414139 (+)
G1392630 NA non-coding downstream 20160 57417337 ~ 57417780 (+)
G1392790 NA non-coding downstream 220171 57617348 ~ 57617810 (+)
G1392851 NA non-coding downstream 302909 57700086 ~ 57701543 (+)
G1392601 NA other upstream 30423 57365951 ~ 57366517 (+)
G1391254 NA other upstream 1150067 56246515 ~ 56247620 (+)
G1390616 LOC106566696 other upstream 1573748 55793024 ~ 55823192 (+)
G1390527 NA other upstream 1756641 55640022 ~ 55640299 (+)
G1392617 NA other downstream 4308 57401485 ~ 57402530 (+)
G1393570 LOC106566761 other downstream 1022209 58419386 ~ 58423502 (+)
G1393647 LOC106613431 other downstream 1168959 58566136 ~ 58566794 (+)
LOC110492427 brpf1 other downstream 1881942 59278960 ~ 59290653 (+)
G1394888 NA other downstream 1908397 59305574 ~ 59306035 (+)

Expression


G1392616 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1392616 Expression in each Bioproject

Bar chart with 8 bars.
G1392616 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 6.
End of interactive chart.

Co-expression Network