G1393448 (LOC106566746)


Basic Information

Item Value
gene id G1393448
gene name LOC106566746
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 58161320 ~ 58162005 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1591264
CTAAATTCACAAAGCTCATAACCATGTCTGCGTCGTTTAGCAAGTTGTTGTCCTGTAGAGTTGCTATCGGCGGCCCCTGGGTGGTGAAGACGGGTTTGTATGGATAGGAGTACGCGTCCTCTTCCCCCTCCGTGGACATGGCATTGTACAGGTCCATCATGAACATTGGGGCCGCGTTGTGCTTCCCGTGGAGATGCGGTCGCGGCCGATGTGGGAGCCCGAGTATCGAAAGGATTTCCCGCTGCATCTCCCTGCGCTCCTGGCTTTTCAGCCGCCGGTGGATGAAACTCGAGTGGACCTCATTGTCCAGGGTAAAGTTAGAAAATACTGTGTCCGCCAGGACGCAGTAGCCCCATACGAGGAACAAAGCAGGGGCACGTCTATCCAAAAATGAAACCATTTTGATGCCGTGCGTAATTGCGCTGAGTGCTCTAACCCAATTCTTAAAATAAGGATATTGAACTTCGCAACATGTTTTGTTCAATGCCTGAATCATTCACGGCCCCTCATGTTGAGGGAAGAGTTCCCGATTGGAACATACATTTCACTTCAACGTCCACTGTTATTGGATTGCCTTAAAATCCACTGATCTGTACAATTTTGAATTTCGATTATTTTGCCTTTACATCCAGATACTCCGACCTCTTTCACTAGCCTGTCACTGTCTCCCTGGGCCACGCGTAAAC

Function

NR:

description
bone morphogenetic protein 7-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1591264 True 686 lncRNA 0.49 1 58161320 58162005
Loading

Neighbor

gene id symbol gene type direction distance location
LOC110492402 LOC106566744 coding upstream 73064 58040555 ~ 58088256 (+)
LOC118936470 NA coding upstream 197137 57954916 ~ 57964183 (+)
LOC110492396 y4629 coding upstream 273614 57876449 ~ 57887706 (+)
LOC110492391 ss18l1 coding upstream 287543 57853901 ~ 57873777 (+)
LOC110492393 lsm14b coding upstream 311306 57846010 ~ 57850014 (+)
spo11 LOC106566748 coding downstream 12543 58174548 ~ 58184208 (+)
LOC110492405 LOC106566749 coding downstream 24413 58186418 ~ 58195415 (+)
LOC110492406 LOC106566750 coding downstream 37203 58199208 ~ 58207263 (+)
LOC110492407 LOC106566752 coding downstream 101360 58263365 ~ 58278453 (+)
LOC110492411 LOC106566755 coding downstream 156026 58318031 ~ 58335164 (+)
G1393440 NA non-coding upstream 14133 58146962 ~ 58147187 (+)
G1393438 NA non-coding upstream 14743 58145664 ~ 58146577 (+)
G1393436 NA non-coding upstream 19015 58142021 ~ 58142305 (+)
G1393430 NA non-coding upstream 27007 58134027 ~ 58134313 (+)
G1393428 NA non-coding upstream 29168 58131944 ~ 58132152 (+)
G1393453 NA non-coding downstream 6806 58168811 ~ 58169496 (+)
G1393496 NA non-coding downstream 53584 58215589 ~ 58215835 (+)
G1393500 NA non-coding downstream 57056 58219061 ~ 58219294 (+)
G1393509 NA non-coding downstream 76846 58238851 ~ 58239360 (+)
G1393517 NA non-coding downstream 87776 58249781 ~ 58250139 (+)
G1392617 NA other upstream 758790 57401485 ~ 57402530 (+)
G1392616 NA other upstream 764143 57396940 ~ 57397177 (+)
G1392601 NA other upstream 794803 57365951 ~ 57366517 (+)
LOC118939462 LOC106566730 other upstream 1370639 56779988 ~ 56790929 (+)
G1391254 NA other upstream 1914447 56246515 ~ 56247620 (+)
G1393570 LOC106566761 other downstream 257381 58419386 ~ 58423502 (+)
G1393647 LOC106613431 other downstream 404131 58566136 ~ 58566794 (+)
LOC110492427 brpf1 other downstream 1117114 59278960 ~ 59290653 (+)
G1394888 NA other downstream 1143569 59305574 ~ 59306035 (+)
G1395932 NA other downstream 2158798 60320803 ~ 60336069 (+)

Expression

G1393448(LOC106566746) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1393448(LOC106566746) Expression in each Bioproject

Bar chart with 6 bars.
G1393448(LOC106566746) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 7.
End of interactive chart.

Co-expression Network