G1393509



Basic Information


Item Value
gene id G1393509
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 58238851 ~ 58239360 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1591335
tatgtgtcggggggctggggtcagtttgctatatctggagtacttctcctgtcttattcggtgtcctgtgtgaatctaagtgtgcgttctctccttctctctttctttctttctttctctctctcggaggacctgagccctaggaccatgccccaggaatacctgacatgatgactccttgctgtccccagtcaacctgaccgtgctgctgctccagtttaaactgttctgccttattattattcgaccatgctggtcatttatga

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1591335 True 266 lncRNA 0.48 2 58238851 58239360
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110492406 LOC106566750 coding upstream 31588 58199208 ~ 58207263 (+)
LOC110492405 LOC106566749 coding upstream 43436 58186418 ~ 58195415 (+)
spo11 LOC106566748 coding upstream 54643 58174548 ~ 58184208 (+)
LOC110492402 LOC106566744 coding upstream 150595 58040555 ~ 58088256 (+)
LOC118936470 NA coding upstream 274668 57954916 ~ 57964183 (+)
LOC110492407 LOC106566752 coding downstream 24005 58263365 ~ 58278453 (+)
LOC110492411 LOC106566755 coding downstream 78671 58318031 ~ 58335164 (+)
LOC110492412 LOC106566754 coding downstream 108093 58347453 ~ 58363312 (+)
LOC110492416 cnbp coding downstream 156101 58395461 ~ 58399157 (+)
LOC110492415 LOC106566758 coding downstream 160269 58399629 ~ 58406067 (+)
G1393500 NA non-coding upstream 19557 58219061 ~ 58219294 (+)
G1393496 NA non-coding upstream 23016 58215589 ~ 58215835 (+)
G1393453 NA non-coding upstream 69355 58168811 ~ 58169496 (+)
G1393448 LOC106566746 non-coding upstream 76846 58161320 ~ 58162005 (+)
G1393440 NA non-coding upstream 91664 58146962 ~ 58147187 (+)
G1393517 NA non-coding downstream 10421 58249781 ~ 58250139 (+)
G1393527 NA non-coding downstream 42830 58282190 ~ 58282472 (+)
G1393534 NA non-coding downstream 54800 58294160 ~ 58294389 (+)
G1393554 NA non-coding downstream 139864 58379224 ~ 58380701 (+)
G1393559 NA non-coding downstream 143815 58383175 ~ 58412205 (+)
G1392617 NA other upstream 836321 57401485 ~ 57402530 (+)
G1392616 NA other upstream 841674 57396940 ~ 57397177 (+)
G1392601 NA other upstream 872334 57365951 ~ 57366517 (+)
LOC118939462 LOC106566730 other upstream 1448170 56779988 ~ 56790929 (+)
G1391254 NA other upstream 1991978 56246515 ~ 56247620 (+)
G1393570 LOC106566761 other downstream 180026 58419386 ~ 58423502 (+)
G1393647 LOC106613431 other downstream 326776 58566136 ~ 58566794 (+)
LOC110492427 brpf1 other downstream 1039759 59278960 ~ 59290653 (+)
G1394888 NA other downstream 1066214 59305574 ~ 59306035 (+)
G1395932 NA other downstream 2081443 60320803 ~ 60336069 (+)

Expression


G1393509 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.25.
End of interactive chart.

G1393509 Expression in each Bioproject

Bar chart with 9 bars.
G1393509 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 8.
End of interactive chart.

Co-expression Network