G1393647 (LOC106613431)



Basic Information


Item Value
gene id G1393647
gene name LOC106613431
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 58566136 ~ 58566794 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1591484
aggcaattaaggtcacagttatgaaaacataggacactaaagaggcctttctactgactgaaaaacaccaaaagaaagatgcccagggtcccagctcatctgcgtgaactcgctttaggcatgctgcaaggaggcatgaggactgcagatgtggccagggcaataaattgcaatgtccgtactgtgagacgcctaagacagcgctacagggagacagggcggacagctgatcgtcctcgcagtggcagaccacgtgtaacaacaccttcacaggatcggtacatccgaacattacacctgcgggacaggtccaggatggcaacaacaactgcccgagttacaccaggaaggcacaatccctccattagtgctcagactgtcagcaataggctgagagaggctggaatgagggcttgtaggcctgttgtaaggcaggtcctcaccagacatcaccggcaacaacgtcgcctatgggcgcaaacccaccgtcgctggaccagacaggactggcaaaaagtgctcttcactgacgagtcgcggttttgtctcaccaggagtgatggtcggattcgcatttattgtcgaaggaatgagcgttacaccgaggcctgtactctggagcgggatcgatttggaggtggagggtccgtcatggtctg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1591484 True 659 TUCP 0.53 1 58566136 58566794

Neighbor


gene id symbol gene type direction distance location
LOC118939562 NA coding upstream 68770 58485907 ~ 58497366 (+)
LOC110492415 LOC106566758 coding upstream 160069 58399629 ~ 58406067 (+)
LOC110492416 cnbp coding upstream 166979 58395461 ~ 58399157 (+)
LOC110492412 LOC106566754 coding upstream 202824 58347453 ~ 58363312 (+)
LOC110492411 LOC106566755 coding upstream 230972 58318031 ~ 58335164 (+)
LOC110492418 LOC106571900 coding downstream 177096 58743890 ~ 58792266 (+)
LOC110492421 LOC106566609 coding downstream 338157 58904951 ~ 58988807 (+)
LOC110492422 LOC106566610 coding downstream 433443 59000237 ~ 59112924 (+)
LOC110492423 LOC106566613 coding downstream 578255 59145049 ~ 59158966 (+)
LOC110492424 LOC106566614 coding downstream 607201 59173995 ~ 59178572 (+)
G1393645 NA non-coding upstream 1239 58564619 ~ 58564897 (+)
G1393644 NA non-coding upstream 2090 58563740 ~ 58564046 (+)
G1393642 NA non-coding upstream 4452 58561341 ~ 58561684 (+)
G1393559 NA non-coding upstream 153931 58383175 ~ 58412205 (+)
G1393554 NA non-coding upstream 185435 58379224 ~ 58380701 (+)
G1393658 NA non-coding downstream 13608 58580402 ~ 58580603 (+)
G1393659 NA non-coding downstream 13812 58580606 ~ 58580818 (+)
G1393660 NA non-coding downstream 14091 58580885 ~ 58581199 (+)
G1393662 NA non-coding downstream 16326 58583120 ~ 58583468 (+)
G1393665 NA non-coding downstream 19658 58586452 ~ 58586680 (+)
G1393570 LOC106566761 other upstream 142634 58419386 ~ 58423502 (+)
G1392617 NA other upstream 1163606 57401485 ~ 57402530 (+)
G1392616 NA other upstream 1168959 57396940 ~ 57397177 (+)
G1392601 NA other upstream 1199619 57365951 ~ 57366517 (+)
LOC118939462 LOC106566730 other upstream 1775455 56779988 ~ 56790929 (+)
LOC110492427 brpf1 other downstream 712325 59278960 ~ 59290653 (+)
G1394888 NA other downstream 738780 59305574 ~ 59306035 (+)
G1395932 NA other downstream 1754009 60320803 ~ 60336069 (+)
G1396296 LOC106566651 other downstream 2080466 60647260 ~ 60648050 (+)
G1396313 NA other downstream 2131069 60697863 ~ 60698313 (+)

Expression


G1393647(LOC106613431) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G1393647(LOC106613431) Expression in each Bioproject

Bar chart with 21 bars.
G1393647(LOC106613431) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network