G1393666



Basic Information


Item Value
gene id G1393666
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 58587079 ~ 58587307 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1591503
ggatgagacattcttaccaatttactagagaaccagtttggatttaagtataacttttgtatgactgatgcctttagtgagaggtctaatgctttaatattgaatcatttctgccctccaaattcatattagttatataaataggcccttttaattttatctggcttgccgttccaaataaaatgtaatattttatgttcacataatttaaaaagcatgtcactaggtg

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1591503 True 229 lncRNA 0.31 1 58587079 58587307

Neighbor


gene id symbol gene type direction distance location
LOC118939562 NA coding upstream 89713 58485907 ~ 58497366 (+)
LOC110492415 LOC106566758 coding upstream 181012 58399629 ~ 58406067 (+)
LOC110492416 cnbp coding upstream 187922 58395461 ~ 58399157 (+)
LOC110492412 LOC106566754 coding upstream 223767 58347453 ~ 58363312 (+)
LOC110492411 LOC106566755 coding upstream 251915 58318031 ~ 58335164 (+)
LOC110492418 LOC106571900 coding downstream 156583 58743890 ~ 58792266 (+)
LOC110492421 LOC106566609 coding downstream 317644 58904951 ~ 58988807 (+)
LOC110492422 LOC106566610 coding downstream 412930 59000237 ~ 59112924 (+)
LOC110492423 LOC106566613 coding downstream 557742 59145049 ~ 59158966 (+)
LOC110492424 LOC106566614 coding downstream 586688 59173995 ~ 59178572 (+)
G1393665 NA non-coding upstream 399 58586452 ~ 58586680 (+)
G1393662 NA non-coding upstream 3611 58583120 ~ 58583468 (+)
G1393660 NA non-coding upstream 5880 58580885 ~ 58581199 (+)
G1393659 NA non-coding upstream 6261 58580606 ~ 58580818 (+)
G1393658 NA non-coding upstream 6476 58580402 ~ 58580603 (+)
G1394210 NA non-coding downstream 104038 58691345 ~ 58718116 (+)
G1394209 NA non-coding downstream 104607 58691914 ~ 58693026 (+)
G1394248 NA non-coding downstream 143126 58730433 ~ 58730634 (+)
G1394296 NA non-coding downstream 209819 58797126 ~ 58797403 (+)
G1393647 LOC106613431 other upstream 20285 58566136 ~ 58566794 (+)
G1393570 LOC106566761 other upstream 163577 58419386 ~ 58423502 (+)
G1392617 NA other upstream 1184549 57401485 ~ 57402530 (+)
G1392616 NA other upstream 1189902 57396940 ~ 57397177 (+)
G1392601 NA other upstream 1220562 57365951 ~ 57366517 (+)
LOC110492427 brpf1 other downstream 691812 59278960 ~ 59290653 (+)
G1394888 NA other downstream 718267 59305574 ~ 59306035 (+)
G1395932 NA other downstream 1733496 60320803 ~ 60336069 (+)
G1396296 LOC106566651 other downstream 2059953 60647260 ~ 60648050 (+)
G1396313 NA other downstream 2110556 60697863 ~ 60698313 (+)

Expression


G1393666 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G1393666 Expression in each Bioproject

Bar chart with 18 bars.
G1393666 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network