XLOC_032964 (CR385041.1)


Basic Information

Item Value
gene id XLOC_032964
gene name CR385041.1
gene type non-coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007117.7
NCBI id CM002890.2
chromosome length 60270059
location 34644253 ~ 34644370 (-)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00064052
gccagcagctagctctctgaaactcttatatggttgcccactgaagctaagcaggtctgtgccaggtcagtacctggatggggcagtaccacatgggaaagctaggttgctgctagaa

Function

GO: NA

KEGG: NA

Ensembl:

ensembl_id ENSDARG00000084970

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00064052 True 118 rRNA 0.53 1 34644253 34644370
Loading

Neighbor

gene id symbol gene type direction distance location
XLOC_032963 dmrt2b coding downstream 423612 34213971 ~ 34220641 (-)
XLOC_032962 NA coding downstream 466355 34158617 ~ 34177898 (-)
XLOC_032961 fam183a coding downstream 502318 34138386 ~ 34141935 (-)
XLOC_032960 mpl coding downstream 635352 33949280 ~ 34008901 (-)
XLOC_032959 prpf38a coding downstream 712557 33926829 ~ 33931696 (-)
XLOC_032965 NA coding upstream 5425 34649795 ~ 34652139 (-)
XLOC_032966 NA coding upstream 172813 34817183 ~ 34818189 (-)
XLOC_032967 mier1a coding upstream 179351 34823721 ~ 34838413 (-)
XLOC_032968 slc35d1a coding upstream 202906 34847276 ~ 34860590 (-)
XLOC_032969 serbp1a coding upstream 287227 34931597 ~ 34938746 (-)
XLOC_032955 CR855206.1 non-coding downstream 918105 33726047 ~ 33726148 (-)
XLOC_032953 CR933860.1 non-coding downstream 1200798 33443334 ~ 33443455 (-)
XLOC_032952 NA non-coding downstream 1433865 33190582 ~ 33210388 (-)
XLOC_032946 NA non-coding downstream 1956867 32687002 ~ 32687386 (-)
XLOC_032973 NA non-coding upstream 440662 35085032 ~ 35090195 (-)
XLOC_032979 NA non-coding upstream 1104696 35749066 ~ 35749921 (-)
XLOC_032980 CU137680.2 non-coding upstream 1266128 35910498 ~ 35914713 (-)

Expression

Expression of XLOC_032964(CR385041.1) in the Zebrafish Sample from each Developmental Stage of PRJEB12982

Boxplot with 18 boxes. Box plot charts are typically used to display groups of statistical data. Each data point in the chart can have up to 5 values: minimum, lower quartile, median, upper quartile, and maximum.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: -0.5 to 0.5.
End of interactive chart.

Expression of XLOC_032964(CR385041.1) in the Zebrafish Sample of PRJEB12982

Bar chart with 360 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network