G1405540


Basic Information

Item Value
gene id G1405540
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 69958066 ~ 69958873 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1605247
gagctctataggagaaagccctgcctccagctgtttgcttaaaaattctagggacaattaggaggcctgcgtcttgtgaccgtagcgtacgtgtaggtatgtacggcaggaccaaatcagagagataggtaggagcaagcccatgtaatactttgtaggttagcagtaaaaccttgaaatcagcccttgctttgacaggaagccagtgtagagaggatagcactggagtaatatgatcaaattttttggttctagtcaggattctagcagccgtatttagcactaactgaagtttatttagtgctttatccgggtagccggaaagtagagcattgcagtagtctaacctggaagtgacaaaagcatggattaatttttctgcatcatttttggacagaaagtttctgatttttgcaatgttacgtagatggaaaaaagctgtccttgaaatggtcttgatatgttcttcaaaagagagatcagggtccagagtaacgccgaggtccttcacagttttatttgagacgactgtacaaccattaagattaattgtcagattcaacagaagatctctttgtttcttgggacctagaacaagcatctctgttttgtccgagtttaaaagtagaaagtttgcagccatccacttccttatgtctgaaacacattcttctagcaagggcaattttggggcttcaccatgtttaattgaaatgtacagctgtgtgtcatccgcatagcagtgaaagttaacattatgttttcgaatgacatccccaagaggtaaaatatatagtgaaaacaatag

Function

NR:

description
ORF2 protein

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1605247 True 808 lncRNA 0.40 1 69958066 69958873
Loading

Neighbor

gene id symbol gene type direction distance location
LOC110492656 LOC106566444 coding upstream 261663 69693022 ~ 69696403 (+)
LOC118939480 NA coding upstream 529225 69428060 ~ 69428841 (+)
LOC110492642 LOC106566441 coding upstream 610511 69313323 ~ 69347555 (+)
fkbp1ab LOC100705189 coding upstream 645862 69305670 ~ 69312263 (+)
LOC110492640 mfsd2 coding upstream 652674 69289013 ~ 69305392 (+)
LOC110492659 LOC106566420 coding downstream 27304 69986177 ~ 69996398 (+)
LOC118939577 LOC106566421 coding downstream 84375 70043248 ~ 70069326 (+)
LOC110492657 hck coding downstream 119820 70078693 ~ 70095267 (+)
LOC110492652 LOC106566422 coding downstream 137576 70096449 ~ 70111837 (+)
LOC110492666 NA coding downstream 232919 70191792 ~ 70194430 (+)
G1405511 NA non-coding upstream 34240 69923614 ~ 69923826 (+)
G1405499 NA non-coding upstream 45825 69911739 ~ 69912241 (+)
G1405493 NA non-coding upstream 50743 69907110 ~ 69907323 (+)
G1405481 NA non-coding upstream 75069 69882747 ~ 69882997 (+)
G1405480 NA non-coding upstream 76543 69881239 ~ 69881523 (+)
G1405545 NA non-coding downstream 6673 69965546 ~ 69965767 (+)
G1405569 NA non-coding downstream 58608 70017481 ~ 70018006 (+)
G1405575 NA non-coding downstream 75591 70034464 ~ 70037203 (+)
G1405584 NA non-coding downstream 93716 70052589 ~ 70053627 (+)
G1405603 NA non-coding downstream 165297 70124170 ~ 70125683 (+)
G1405310 LOC106566443 other upstream 285392 69671464 ~ 69672674 (+)
G1405218 NA other upstream 371160 69585989 ~ 69586906 (+)
G1405216 NA other upstream 374440 69580729 ~ 69583626 (+)
G1404827 NA other upstream 588690 69364521 ~ 69369376 (+)
G1405605 LOC106566425 other downstream 171048 70129921 ~ 70132301 (+)
G1405676 NA other downstream 297949 70256822 ~ 70257430 (+)
G1406381 NA other downstream 1010742 70969615 ~ 70972604 (+)
G1406424 NA other downstream 1243569 71202442 ~ 71206092 (+)
G1406505 NA other downstream 1251399 71210272 ~ 71210764 (+)

Expression

G1405540 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 60.
End of interactive chart.

G1405540 Expression in each Bioproject

Bar chart with 20 bars.
G1405540 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 2000.
End of interactive chart.

Co-expression Network