G1407069



Basic Information


Item Value
gene id G1407069
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 71967599 ~ 71967983 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1607299
gagacagttggtacgttgtaattctttgaaaaagttccctttttccgtgaaattggaatatctcaattgcatcctcctcacatcttttctcctctcatcactccaaattctcaagactcattggttgagaaaagcagaacactctccactctgacctttccaccaatgtgttcaatgacatgtttgaaaaggctctgctgagattcgaactcaggatctcctgtttactagacaggcgctttaaccaactaagccacagcgcctgtagatgccaagtatgttccaggtaagaacaccgccacacgtatttatatcaaacatgtctcattcatttaacccatatctctgtcttgcaaaatcacgtcacaaaacagatgttatttac

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1607299 True 385 lncRNA 0.41 1 71967599 71967983
Loading

Neighbor


gene id symbol gene type direction distance location
trnah-gug-76 NA coding upstream 4639 71962889 ~ 71962960 (+)
trnat-agu-123 NA coding upstream 4993 71962533 ~ 71962606 (+)
trnat-agu-122 NA coding upstream 6369 71961157 ~ 71961230 (+)
trnah-gug-75 NA coding upstream 7386 71960142 ~ 71960213 (+)
trnat-agu-121 NA coding upstream 7741 71959785 ~ 71959858 (+)
trnat-agu-137 NA coding downstream 157977 72125960 ~ 72126033 (+)
trnah-gug-90 NA coding downstream 158325 72126308 ~ 72126379 (+)
trnat-agu-138 NA coding downstream 158915 72126898 ~ 72126971 (+)
trnah-gug-91 NA coding downstream 159264 72127247 ~ 72127318 (+)
trnat-agu-139 NA coding downstream 159854 72127837 ~ 72127910 (+)
G1407050 NA non-coding upstream 1956 71932045 ~ 71965643 (+)
G1407047 NA non-coding upstream 5074 71949328 ~ 71962525 (+)
trnah-gug-53 NA non-coding upstream 45859 71913064 ~ 71921740 (+)
G1407033 NA non-coding upstream 68215 71899063 ~ 71899384 (+)
G1406880 NA non-coding upstream 81513 71885647 ~ 71886086 (+)
G1407073 NA non-coding downstream 6648 71974631 ~ 71982206 (+)
G1407079 NA non-coding downstream 19090 71987073 ~ 71988595 (+)
G1407084 NA non-coding downstream 31148 71999131 ~ 72008977 (+)
G1407085 NA non-coding downstream 41147 72009130 ~ 72035634 (+)
G1407115 NA non-coding downstream 72410 72040393 ~ 72040667 (+)
G1406555 NA other upstream 551172 71413557 ~ 71416427 (+)
G1406510 NA other upstream 710622 71255979 ~ 71256977 (+)
G1406509 NA other upstream 715955 71251074 ~ 71251644 (+)
G1406508 NA other upstream 721576 71245573 ~ 71246023 (+)
G1406507 NA other upstream 751169 71214377 ~ 71216430 (+)
G1407190 NA other downstream 135403 72103386 ~ 72103841 (+)
G1407199 LOC106566391 other downstream 248330 72216313 ~ 72279555 (+)
ngrn ngrn other downstream 674000 72641881 ~ 72646008 (+)
G1407509 NA other downstream 797919 72765902 ~ 72769218 (+)
LOC110492598 LOC106566362 other downstream 840747 72808730 ~ 72818165 (+)

Expression


G1407069 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G1407069 Expression in each Bioproject

Bar chart with 10 bars.
G1407069 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network