G1407228



Basic Information


Item Value
gene id G1407228
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 72150668 ~ 72150878 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1607488
ggcccagaagctaggatatgcatattattagtagatttggatagaaaacacgctgacgtttctaaaactgtttgaatgatgtctgtgagtataacagaactcatatggcaggcgaaaacctgagaaaaatccaaccaggaagtgggaaatctaaggtttgtagtttttcaagtgattgcctatccaatgtactgtgtctatggggtcatat

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1607488 True 211 lncRNA 0.39 1 72150668 72150878
Loading

Neighbor


gene id symbol gene type direction distance location
trnat-agu-147 NA coding upstream 4214 72146381 ~ 72146454 (+)
trnah-gug-107 NA coding upstream 5744 72144853 ~ 72144924 (+)
trnat-agu-146 NA coding upstream 6089 72144506 ~ 72144579 (+)
trnat-agu-145 NA coding upstream 7027 72143568 ~ 72143641 (+)
trnah-gug-106 NA coding upstream 7619 72142978 ~ 72143049 (+)
LOC110492677 LOC106592833 coding downstream 9869 72160747 ~ 72162162 (+)
LOC110492676 nattl coding downstream 25242 72176120 ~ 72249786 (+)
LOC110492682 LOC106592833 coding downstream 95284 72246162 ~ 72249506 (+)
LOC118939586 NA coding downstream 95810 72235921 ~ 72263207 (+)
LOC110492683 nattl coding downstream 112458 72263336 ~ 72264755 (+)
trnat-agu-144 NA non-coding upstream 4015 72125351 ~ 72146653 (+)
G1407222 NA non-coding upstream 15531 72133871 ~ 72135137 (+)
G1407213 NA non-coding upstream 26960 72116615 ~ 72123708 (+)
G1407185 NA non-coding upstream 50023 72100433 ~ 72100645 (+)
G1407180 NA non-coding upstream 52895 72097455 ~ 72097773 (+)
G1407229 NA non-coding downstream 1703 72152581 ~ 72152808 (+)
G1407234 NA non-coding downstream 8776 72159654 ~ 72159909 (+)
G1407209 NA non-coding downstream 56575 72207453 ~ 72327811 (+)
G1407190 NA other upstream 46827 72103386 ~ 72103841 (+)
G1406555 NA other upstream 734241 71413557 ~ 71416427 (+)
G1406510 NA other upstream 893691 71255979 ~ 71256977 (+)
G1406509 NA other upstream 899024 71251074 ~ 71251644 (+)
G1406508 NA other upstream 904645 71245573 ~ 71246023 (+)
G1407199 LOC106566391 other downstream 65435 72216313 ~ 72279555 (+)
ngrn ngrn other downstream 491105 72641881 ~ 72646008 (+)
G1407509 NA other downstream 615024 72765902 ~ 72769218 (+)
LOC110492598 LOC106566362 other downstream 657852 72808730 ~ 72818165 (+)
LOC110491159 LOC105013496 other downstream 674643 72824995 ~ 72894201 (+)

Expression


G1407228 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

G1407228 Expression in each Bioproject

Bar chart with 17 bars.
G1407228 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network