G1408618



Basic Information


Item Value
gene id G1408618
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 73224744 ~ 73225056 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1609190
TCACTGTGTAGGAGACATCTACTCTGTAGTCCTCACTGTGTAGGAGACAACCTACTCTGTAGTCTTCTCTAGGTCACTGTGTAGGAGACATCTACTCTGTAGTCTTCTCTAGGTCACTGTGTAGGAGACATCTACTCTGTAGTCTTCTCTAGGTCACTGTGTAGGAGACATCTACTCTGTAGTCCTCACTGTGTAGGAGACAACCTACTCTGTAGTCTTCTCTAGGTCACTGTGTAGGAG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1609190 True 240 lncRNA 0.46 2 73224744 73225056

Neighbor


gene id symbol gene type direction distance location
LOC110492609 LOC106566381 coding downstream 57351 73147296 ~ 73167393 (-)
LOC110491162 LOC106566379 coding downstream 80456 73115423 ~ 73144288 (-)
si:ch211-150o23.3 LOC106566377 coding downstream 124478 73092421 ~ 73100266 (-)
LOC110492600 LOC106566373 coding downstream 177072 73040535 ~ 73047672 (-)
LOC110491158 LOC106566369 coding downstream 294978 72904370 ~ 72929766 (-)
LOC118939590 NA coding upstream 9460 73222996 ~ 73236615 (-)
LOC110492449 LOC106572884 coding upstream 485073 73710129 ~ 73742096 (-)
ppdpfb LOC106566296 coding upstream 545126 73769856 ~ 73777432 (-)
LOC110492451 LOC106566294 coding upstream 557943 73782999 ~ 73822236 (-)
LOC110492453 LOC106566293 coding upstream 607812 73832868 ~ 73867578 (-)
G1408613 NA non-coding downstream 6993 73217360 ~ 73217751 (-)
G1408612 NA non-coding downstream 7759 73216512 ~ 73216985 (-)
G1408611 NA non-coding downstream 13931 73210459 ~ 73210813 (-)
G1408609 NA non-coding downstream 25364 73196403 ~ 73199380 (-)
G1408606 NA non-coding downstream 36194 73188345 ~ 73188550 (-)
G1408621 NA non-coding upstream 14222 73239278 ~ 73240134 (-)
G1408622 NA non-coding upstream 18039 73243095 ~ 73243345 (-)
G1408623 NA non-coding upstream 19441 73244497 ~ 73244867 (-)
G1408625 NA non-coding upstream 21039 73246095 ~ 73246681 (-)
G1408628 NA non-coding upstream 24296 73249352 ~ 73250128 (-)
G1407755 NA other downstream 786897 72435429 ~ 72437847 (-)
G1407628 NA other downstream 892029 72331806 ~ 72332715 (-)
G1406752 NA other downstream 1678899 71501118 ~ 71547366 (-)
G1406760 NA other downstream 1681275 71539958 ~ 71543469 (-)
G1406514 NA other downstream 1963927 71260322 ~ 71260817 (-)
G1408615 NA other upstream 5756 73230812 ~ 73232954 (-)
rps21 LOC106572905 other upstream 947817 74172873 ~ 74182639 (-)
G1409044 NA other upstream 970469 74195525 ~ 74195951 (-)
G1409407 NA other upstream 1511377 74736433 ~ 74739189 (-)

Expression


G1408618 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G1408618 Expression in each Bioproject

Bar chart with 6 bars.
G1408618 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network