G1408771



Basic Information


Item Value
gene id G1408771
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 73527140 ~ 73528111 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1609375
gtatagggtagtgtgtagtctaggtattgtaaagggtagtgtgtagtctaggtattgtgtagggtagtgtgtagtctaggtattgtatagggtagtgtgtagtctaggtattgtatagggtagtgtgtagcctaggtattgtatagggtagtgtgtagtctaggtattgtaaagggtagtgtgtagtctaggtattgtatagggtattgtat

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1609375 True 212 lncRNA 0.40 2 73527140 73528111

Neighbor


gene id symbol gene type direction distance location
LOC118939590 NA coding downstream 290525 73222996 ~ 73236615 (-)
LOC110492609 LOC106566381 coding downstream 359747 73147296 ~ 73167393 (-)
LOC110491162 LOC106566379 coding downstream 382852 73115423 ~ 73144288 (-)
si:ch211-150o23.3 LOC106566377 coding downstream 426874 73092421 ~ 73100266 (-)
LOC110492600 LOC106566373 coding downstream 479468 73040535 ~ 73047672 (-)
LOC110492449 LOC106572884 coding upstream 182018 73710129 ~ 73742096 (-)
ppdpfb LOC106566296 coding upstream 242071 73769856 ~ 73777432 (-)
LOC110492451 LOC106566294 coding upstream 254888 73782999 ~ 73822236 (-)
LOC110492453 LOC106566293 coding upstream 304757 73832868 ~ 73867578 (-)
lama5 lama5 coding upstream 351077 73879188 ~ 74155898 (-)
G1408768 NA non-coding downstream 2815 73524025 ~ 73524325 (-)
G1408756 NA non-coding downstream 34414 73491942 ~ 73492726 (-)
G1408730 NA non-coding downstream 103001 73423193 ~ 73424139 (-)
G1408728 NA non-coding downstream 106225 73420558 ~ 73420915 (-)
G1408711 NA non-coding downstream 137023 73389908 ~ 73390117 (-)
G1408841 NA non-coding upstream 95060 73623171 ~ 73625000 (-)
G1408846 NA non-coding upstream 102611 73630722 ~ 73631186 (-)
G1408866 NA non-coding upstream 145527 73673638 ~ 73673933 (-)
G1408867 NA non-coding upstream 149048 73677159 ~ 73677474 (-)
G1408869 NA non-coding upstream 152374 73680485 ~ 73680686 (-)
G1408615 NA other downstream 294186 73230812 ~ 73232954 (-)
G1407755 NA other downstream 1089293 72435429 ~ 72437847 (-)
G1407628 NA other downstream 1194425 72331806 ~ 72332715 (-)
G1406752 NA other downstream 1981295 71501118 ~ 71547366 (-)
rps21 LOC106572905 other upstream 644762 74172873 ~ 74182639 (-)
G1409044 NA other upstream 667414 74195525 ~ 74195951 (-)
G1409407 NA other upstream 1208322 74736433 ~ 74739189 (-)
G1409430 LOC106566333 other upstream 1316993 74845104 ~ 74847937 (-)

Expression


G1408771 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 50.
End of interactive chart.

G1408771 Expression in each Bioproject

Bar chart with 13 bars.
G1408771 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network