G1409456



Basic Information


Item Value
gene id G1409456
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 74888804 ~ 74889421 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1610298
agtacgtttatctctaggagacagaacgcgtctccttcctgagcggtatgacggctgcgtggtcccatggtgtttatacttgcgtactactgtttgtacagataaacgtggtaccttcaggcatttggaaattgttcccaaggatgaaccagacttgtggaggtctacaatttttttctgaggtcttggctgatttcttttgattttcccatgatgtcaagcaaagaggcactgagtttgaaggtaggccttgaaatacatccacaggtacagctccaattgactcaaatgatgtcaattagcctatcagaagcttctaaagccatgacataattttctggaattttccaagctgtttaaaggcacagtcaacttagtgtatgtaaacttctgacccactggaattgtgatacagttaattataagtaaaataatctttctgtaaacaattgttggaaaaattccttgtctcatgcacaaagtagaccgaccgaaccgacttgccaaaactatagtttgctaacaagaaatttgtggagtggttgaaaaactagttttaatgactccaaccgaagtgaatgcaaacttctgacttcaactgtatgtacagtattcatg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1610298 True 618 lncRNA 0.39 1 74888804 74889421

Neighbor


gene id symbol gene type direction distance location
LOC110510930 LOC106566333 coding upstream 42819 74825301 ~ 74845985 (+)
LOC110516815 syp coding upstream 74326 74779046 ~ 74814478 (+)
adrm1 adrm1 coding upstream 1009695 73869288 ~ 73879109 (+)
LOC118939592 NA coding upstream 1057030 73827832 ~ 73833251 (+)
trnae-cuc-170 NA coding upstream 1110976 73777757 ~ 73777828 (+)
LOC118939595 NA coding downstream 125423 75014844 ~ 75015721 (+)
LOC110491181 fgd1 coding downstream 194803 75084224 ~ 75306912 (+)
LOC110492701 tfe3 coding downstream 424518 75313939 ~ 75369314 (+)
LOC110492697 LOC106566359 coding downstream 698172 75587593 ~ 75590524 (+)
oprl1 LOC106566357 coding downstream 928056 75817477 ~ 75880841 (+)
G1409453 NA non-coding upstream 7420 74880873 ~ 74881384 (+)
G1409449 NA non-coding upstream 14691 74873902 ~ 74874113 (+)
G1409369 NA non-coding upstream 64207 74824205 ~ 74824597 (+)
G1409367 NA non-coding upstream 66391 74822178 ~ 74822413 (+)
G1409348 NA non-coding upstream 130456 74758035 ~ 74758348 (+)
G1409483 NA non-coding downstream 13864 74903285 ~ 74903509 (+)
G1409484 LOC100136012 non-coding downstream 14322 74903743 ~ 74903966 (+)
G1409490 NA non-coding downstream 22521 74911942 ~ 74912203 (+)
G1409491 NA non-coding downstream 23016 74912437 ~ 74912670 (+)
G1409498 NA non-coding downstream 31425 74920846 ~ 74921081 (+)
G1408335 NA other upstream 1084470 73803131 ~ 73804334 (+)
G1408313 NA other upstream 1116238 73769846 ~ 73773319 (+)
LOC110491178 LOC106572904 other upstream 1225972 73324102 ~ 73662832 (+)
G1408176 NA other upstream 1462538 73425747 ~ 73426266 (+)
G1407566 NA other upstream 1959085 72911983 ~ 72929719 (+)
G1410289 NA other downstream 1056115 75945536 ~ 75945963 (+)
G1410291 NA other downstream 1056575 75945996 ~ 75946333 (+)
LOC118939596 LOC106566356 other downstream 1075004 75964289 ~ 76061287 (+)
LOC110492698 LOC106566354 other downstream 1275570 76164892 ~ 76168083 (+)
G1410525 NA other downstream 1365538 76253221 ~ 76262727 (+)

Expression


G1409456 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 200.
End of interactive chart.

G1409456 Expression in each Bioproject

Bar chart with 21 bars.
G1409456 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 6000.
End of interactive chart.

Co-expression Network