G1411281



Basic Information


Item Value
gene id G1411281
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 77165458 ~ 77165823 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1612655
gcaaggagctgccagtctgcaaggagctgtcagtctgcatggagctgccagtctgcaaggagccgccagagctgcctgtctgcaggatgccgccagagctgccagtctgcaaggagccgccagagctgccagtctgcaaggagcagccagagctgccagtcagcatggagcagccagtcagcatggagcagccagagctgccagtcagcatagagcagccagagctgccag

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1612655 True 231 TUCP 0.63 2 77165458 77165823
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110491186 LOC106572997 coding downstream 20660 77138689 ~ 77144798 (-)
LOC110492706 LOC106566322 coding downstream 60741 77102080 ~ 77104717 (-)
LOC118939598 LOC106572974 coding downstream 168438 76807151 ~ 76997020 (-)
LOC110514470 uba1 coding downstream 390694 76705789 ~ 76774764 (-)
usp21 LOC106566311 coding downstream 471700 76657903 ~ 76693758 (-)
ikbkg LOC106572992 coding upstream 328037 77493860 ~ 77582658 (-)
flna LOC100380643 coding upstream 789776 77955599 ~ 78024979 (-)
LOC118939482 NA coding upstream 862384 78028207 ~ 78029944 (-)
dnase1l1 LOC106566338 coding upstream 905796 78071619 ~ 78096380 (-)
LOC110512774 LOC106566310 coding upstream 938757 78104580 ~ 78137424 (-)
G1411242 NA non-coding downstream 71183 77092803 ~ 77094275 (-)
G1411015 NA non-coding downstream 74934 77090266 ~ 77090524 (-)
G1411012 NA non-coding downstream 77111 77088145 ~ 77088347 (-)
G1410999 NA non-coding downstream 98641 77066601 ~ 77066817 (-)
G1411343 NA non-coding upstream 150372 77316195 ~ 77317524 (-)
G1411364 NA non-coding upstream 178680 77344503 ~ 77345246 (-)
G1411385 NA non-coding upstream 219356 77385179 ~ 77385505 (-)
G1411407 NA non-coding upstream 288677 77454500 ~ 77456086 (-)
G1411417 NA non-coding upstream 309378 77475201 ~ 77475625 (-)
G1410911 NA other downstream 193339 76961470 ~ 76972119 (-)
G1410776 LOC106591762 other downstream 368347 76795583 ~ 76797111 (-)
G1410773 NA other downstream 370405 76792420 ~ 76795053 (-)
G1410701 NA other downstream 519794 76642780 ~ 76645664 (-)
G1410696 NA other downstream 607284 76557040 ~ 76558174 (-)
G1411366 NA other upstream 183730 77349553 ~ 77351225 (-)
G1411862 NA other upstream 884443 78050266 ~ 78053138 (-)
G1411845 rl10 other upstream 891144 78056967 ~ 78067510 (-)
G1412091 NA other upstream 1150494 78316317 ~ 78318998 (-)
G1412203 LOC100136012 other upstream 1338468 78504291 ~ 78511632 (-)

Expression


G1411281 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1411281 Expression in each Bioproject

Bar chart with 19 bars.
G1411281 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network