G1411453



Basic Information


Item Value
gene id G1411453
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 77610766 ~ 77611074 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1612864
aatcaaatcaaatcaaattttatttgtcacatacacatggttagcagatgttaatgcgagtgtagcgaaatgcttgtgcttctagttccgacaatgcagtaataacaagtaatctaactaacaattccaaaactactgtcttgtacacagtgtaaggggataaagaatatgtacataagggtatatgaatgagtgatggtacagagcagcataggcaagatacagtagatggtatcgggtacagtatgtacaatgagatgagtatgtaaacaaagtggcatagtatagtataaagtggctagtgataca

Function


NR:

description
LOW QUALITY PROTEIN: transcription and mRNA export factor ENY2-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1612864 True 309 lncRNA 0.36 1 77610766 77611074

Neighbor


gene id symbol gene type direction distance location
ikbkg LOC106572992 coding downstream 28108 77493860 ~ 77582658 (-)
LOC110491186 LOC106572997 coding downstream 465968 77138689 ~ 77144798 (-)
LOC110492706 LOC106566322 coding downstream 506049 77102080 ~ 77104717 (-)
LOC118939598 LOC106572974 coding downstream 613746 76807151 ~ 76997020 (-)
LOC110514470 uba1 coding downstream 836002 76705789 ~ 76774764 (-)
flna LOC100380643 coding upstream 344525 77955599 ~ 78024979 (-)
LOC118939482 NA coding upstream 417133 78028207 ~ 78029944 (-)
dnase1l1 LOC106566338 coding upstream 460545 78071619 ~ 78096380 (-)
LOC110512774 LOC106566310 coding upstream 493506 78104580 ~ 78137424 (-)
ndnl2 LOC106593143 coding upstream 556891 78167965 ~ 78193667 (-)
G1411449 NA non-coding downstream 1444 77607265 ~ 77609322 (-)
G1411442 NA non-coding downstream 16036 77594399 ~ 77594730 (-)
G1411438 NA non-coding downstream 36367 77571944 ~ 77574399 (-)
G1411433 NA non-coding downstream 64841 77537669 ~ 77545925 (-)
G1411259 NA non-coding downstream 117031 77492466 ~ 77493735 (-)
G1411474 NA non-coding upstream 129 77611203 ~ 77611564 (-)
G1411498 LOC106566291 non-coding upstream 36995 77648069 ~ 77653082 (-)
G1411740 NA non-coding upstream 117416 77728490 ~ 77729372 (-)
G1411748 NA non-coding upstream 144302 77755376 ~ 77755913 (-)
G1411752 NA non-coding upstream 148977 77760051 ~ 77761368 (-)
G1411366 NA other downstream 259541 77349553 ~ 77351225 (-)
G1411281 NA other downstream 444943 77165458 ~ 77165823 (-)
G1410911 NA other downstream 638647 76961470 ~ 76972119 (-)
G1410776 LOC106591762 other downstream 813655 76795583 ~ 76797111 (-)
G1410773 NA other downstream 815713 76792420 ~ 76795053 (-)
G1411862 NA other upstream 439192 78050266 ~ 78053138 (-)
G1411845 rl10 other upstream 445893 78056967 ~ 78067510 (-)
G1412091 NA other upstream 705243 78316317 ~ 78318998 (-)
G1412203 LOC100136012 other upstream 893217 78504291 ~ 78511632 (-)

Expression



Co-expression Network