G1411585


Basic Information

Item Value
gene id G1411585
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 77944233 ~ 77945130 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1613036
cagagttcctctgtggagatgggagaaccttccagaatgacaaccatctctgcagactcaaccaatcaggcctttatggtagagtggccagactgaagccactcctcagtaaaaggcacatgacagcccgcttggagttggccaaaaggaacttaaaggactctcagactatgagaaacaagattctctggtctgatgaaaccaatattgagtgttgaggatcagcgtggtggatgtgttgttacctacccttaccacctgggggcgggccatcaagaagtccaggatccagtgttgttacctacccttaccacctgggggcggcccatcaggaagtccaggatccagtgttgttacctacccttaccacctgggggcggcccatcaggaagtccagtgtttagccctccctctgccactggagactcttatctcccttacagatcactacacctgtaaacagcccatctatctacctacctcatccccatactggtatttatttatttatcttgctcctttgcacctcagtatctctacctgcacattcatcttctgccgatctaccattccagtgtttaattcctatattgtaattacttcgccaccatggcctatttatttccttaacttacctcatttgcactcactgtatatagactttttgttttctt

Function

NR:

description
Putative transposase

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1613036 True 674 lncRNA 0.47 2 77944233 77945130
Loading

Neighbor

gene id symbol gene type direction distance location
haus7 haus7 coding upstream 1404 77928168 ~ 77942829 (+)
LOC110515266 atp2b3 coding upstream 111674 77657611 ~ 77832559 (+)
LOC110519365 NA coding upstream 185830 77754223 ~ 77758403 (+)
LOC110492713 LOC106566291 coding upstream 295691 77611662 ~ 77648542 (+)
LOC110515522 LOC106566305 coding upstream 497157 77347958 ~ 77447742 (+)
LOC110532872 rl10 coding downstream 114115 78059245 ~ 78067417 (+)
LOC118939607 NA coding downstream 117525 78062655 ~ 78062787 (+)
LOC118939606 NA coding downstream 120069 78065199 ~ 78065331 (+)
hsd17b10 hsd17b10 coding downstream 203577 78148707 ~ 78167143 (+)
LOC110492717 LOC106593306 coding downstream 543654 78488784 ~ 78511036 (+)
G1411586 NA non-coding upstream 272 77943651 ~ 77943961 (+)
G1411500 NA non-coding upstream 107774 77835701 ~ 77836459 (+)
G1411587 NA non-coding downstream 601 77945731 ~ 77947333 (+)
G1411588 NA non-coding downstream 2640 77947770 ~ 77948102 (+)
G1411582 LOC100380643 non-coding downstream 29704 77974834 ~ 77976781 (+)
G1411638 NA non-coding downstream 95730 78040860 ~ 78041503 (+)
G1411643 NA non-coding downstream 128625 78073755 ~ 78076913 (+)
G1411161 NA other upstream 449892 77492694 ~ 77494341 (+)
G1410994 NA other upstream 882139 77061502 ~ 77062094 (+)
G1410829 NA other upstream 971890 76961443 ~ 76972343 (+)
G1411664 NA other downstream 178180 78123310 ~ 78123962 (+)
G1411988 ccdc115 other downstream 459061 78404191 ~ 78413546 (+)

Expression

G1411585 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

G1411585 Expression in each Bioproject

Bar chart with 20 bars.
G1411585 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network