G1411664


Basic Information

Item Value
gene id G1411664
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 78123310 ~ 78123962 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1613156
atatacagggggtaccggtacagagtcaatgtggaggctatatacagggggtaccggtacagagtcaatgtggaggctatatacagaggggtactggtacagagtcaatgtggaggctatatacagagggtactggtacagagtcaatgtggaggctatatacagagggtactggtacagagtcaatgtggaggctatatacagggtaccggtacagagtcaatgtggaggctatatacagggggtactggtacagagtcaatgtggaggctatatacagggggtactggtacagagtcaatgtggaggctatatacagggggcaccggtacagagtcaatgtggaggctatatacagggggtaccggtacagagtcaatgtggaggctatatacagggggtactggtacagagtcaatgtggaggctatatacagggggcaccggtacagagtcaatgtggaggctatatacagggggtaccggtacagagtcaat

Function

NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1613156 True 497 TUCP 0.49 2 78123310 78123962
Loading

Neighbor

gene id symbol gene type direction distance location
LOC110532872 rl10 coding upstream 55893 78059245 ~ 78067417 (+)
LOC118939606 NA coding upstream 57979 78065199 ~ 78065331 (+)
LOC118939607 NA coding upstream 60523 78062655 ~ 78062787 (+)
haus7 haus7 coding upstream 180481 77928168 ~ 77942829 (+)
LOC110515266 atp2b3 coding upstream 290751 77657611 ~ 77832559 (+)
hsd17b10 hsd17b10 coding downstream 24745 78148707 ~ 78167143 (+)
LOC110492717 LOC106593306 coding downstream 364822 78488784 ~ 78511036 (+)
G1411659 NA non-coding upstream 2541 78116742 ~ 78120769 (+)
G1411651 LOC106572983 non-coding upstream 7719 78102251 ~ 78115591 (+)
G1411643 NA non-coding upstream 46397 78073755 ~ 78076913 (+)
G1411638 NA non-coding upstream 81807 78040860 ~ 78041503 (+)
G1411582 LOC100380643 non-coding upstream 146529 77974834 ~ 77976781 (+)
G1411683 NA non-coding downstream 14108 78138070 ~ 78138347 (+)
G1411684 NA non-coding downstream 14558 78138520 ~ 78138730 (+)
G1411692 NA non-coding downstream 37348 78161310 ~ 78161873 (+)
G1411682 NA non-coding downstream 48092 78172054 ~ 78173294 (+)
G1411679 LOC101154678 non-coding downstream 49437 78173399 ~ 78174826 (+)
G1411161 NA other upstream 628969 77492694 ~ 77494341 (+)
LOC110515522 LOC106566305 other upstream 675568 77347958 ~ 77447742 (+)
G1410994 NA other upstream 1061216 77061502 ~ 77062094 (+)
G1410829 NA other upstream 1150967 76961443 ~ 76972343 (+)
G1410827 NA other upstream 1154323 76958730 ~ 76971677 (+)
G1411988 ccdc115 other downstream 280229 78404191 ~ 78413546 (+)

Expression

G1411664 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G1411664 Expression in each Bioproject

Bar chart with 20 bars.
G1411664 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network