G1411684



Basic Information


Item Value
gene id G1411684
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 78138520 ~ 78138730 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1613177
gtattcatgtaagaaaactctggcaagacatcagtagatttataattgaacacatttatgaagattttacactattatggagagatgtactgcttggactctttacctctttacctacgatagaaataagctgaaacaattttatgtaattaatttcattattcttttggccaaatttcacacaaatgtacatttacaaacaaaacaccac

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1613177 True 211 lncRNA 0.30 1 78138520 78138730
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110532872 rl10 coding upstream 71103 78059245 ~ 78067417 (+)
LOC118939606 NA coding upstream 73189 78065199 ~ 78065331 (+)
LOC118939607 NA coding upstream 75733 78062655 ~ 78062787 (+)
haus7 haus7 coding upstream 195691 77928168 ~ 77942829 (+)
LOC110515266 atp2b3 coding upstream 305961 77657611 ~ 77832559 (+)
hsd17b10 hsd17b10 coding downstream 9977 78148707 ~ 78167143 (+)
LOC110492717 LOC106593306 coding downstream 350054 78488784 ~ 78511036 (+)
G1411683 NA non-coding upstream 173 78138070 ~ 78138347 (+)
G1411659 NA non-coding upstream 17751 78116742 ~ 78120769 (+)
G1411651 LOC106572983 non-coding upstream 22929 78102251 ~ 78115591 (+)
G1411643 NA non-coding upstream 61607 78073755 ~ 78076913 (+)
G1411638 NA non-coding upstream 97017 78040860 ~ 78041503 (+)
G1411692 NA non-coding downstream 22580 78161310 ~ 78161873 (+)
G1411682 NA non-coding downstream 33324 78172054 ~ 78173294 (+)
G1411679 LOC101154678 non-coding downstream 34669 78173399 ~ 78174826 (+)
G1411676 NA non-coding downstream 54482 78193212 ~ 78193552 (+)
G1411699 NA non-coding downstream 56138 78194868 ~ 78195198 (+)
G1411664 NA other upstream 14558 78123310 ~ 78123962 (+)
G1411161 NA other upstream 644179 77492694 ~ 77494341 (+)
LOC110515522 LOC106566305 other upstream 690778 77347958 ~ 77447742 (+)
G1410994 NA other upstream 1076426 77061502 ~ 77062094 (+)
G1410828 NA other upstream 1170886 76961530 ~ 76967634 (+)
G1411988 ccdc115 other downstream 265461 78404191 ~ 78413546 (+)

Expression


G1411684 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1411684 Expression in each Bioproject

Bar chart with 15 bars.
G1411684 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 80.
End of interactive chart.

Co-expression Network