G1412193


Basic Information

Item Value
gene id G1412193
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 78456444 ~ 78456887 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1613833
tcgagagactgacattttttcccattcctccttgcaaaacagctcgagctcagtgaggttggatggagagcatttgtgcacagcagttttcagttctttccacagattctcgattggattcaggtctggactttgacttggccattctaacacctggatatgtttatttttgaaccattccattgtagattttgctttatgtcttggatcattgtcttgttggaagacaaatctccgtcccagtctcaggtcttttgcagactccatcaggttttcttccagaatggtcctgtatttggctccatccatcttcccatcaattttaaccatcttccctgtccctgctgaagaaaagcaggcccaaaccatgatgctgccaccaccatgtttgacagtggggatcgtgtgttcagctgtgttgcttttacgccaaacataacattt

Function

NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1613833 True 444 lncRNA 0.44 1 78456444 78456887
Loading

Neighbor

gene id symbol gene type direction distance location
fkbpl LOC106591935 coding downstream 1983 78441631 ~ 78454461 (-)
trnan-guu-13 NA coding downstream 34393 78421978 ~ 78422051 (-)
trnae-uuc-7 NA coding downstream 37555 78418818 ~ 78418889 (-)
ccdc115 ccdc115 coding downstream 41774 78404170 ~ 78414670 (-)
LOC110492722 LOC106566331 coding downstream 74858 78324077 ~ 78381586 (-)
G1412169 NA non-coding downstream 3176 78452343 ~ 78453268 (-)
G1412145 NA non-coding downstream 95143 78357403 ~ 78361301 (-)
G1412146 NA non-coding downstream 97543 78358500 ~ 78358901 (-)
G1412115 NA non-coding downstream 182367 78273455 ~ 78274077 (-)
G1412200 NA non-coding upstream 26590 78483477 ~ 78483683 (-)
G1412202 NA non-coding upstream 29874 78486761 ~ 78486961 (-)
G1412166 NA non-coding upstream 31855 78488742 ~ 78501434 (-)
G1412171 NA non-coding upstream 33241 78490128 ~ 78498774 (-)
G1412203 LOC100136012 non-coding upstream 52086 78504291 ~ 78511632 (-)
G1412091 NA other downstream 137446 78316317 ~ 78318998 (-)
G1411845 rl10 other downstream 388934 78056967 ~ 78067510 (-)
G1411862 NA other downstream 403306 78050266 ~ 78053138 (-)
G1411366 NA other downstream 1105219 77349553 ~ 77351225 (-)
G1411281 NA other downstream 1290621 77165458 ~ 77165823 (-)

Expression

G1412193 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

G1412193 Expression in each Bioproject

Bar chart with 19 bars.
G1412193 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.

Co-expression Network