mb (mb)



Basic Information


Item Value
gene id mb
gene name mb
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 21491234 ~ 21494421 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>NM_001171862.1
CACGGGACATTTACCTGCTTTACTGATCATGGCTGACTTTGACATGGTTCTGAAGTGCTGGGGGCCAGTGGAGGCTGACTACAACAAACACGGAGGACTGGTTCTGAGCCGTCTGTTTGCAGAGCACCCAGACACCCTGAAGTTGTTCCCTAAGTTCGCAGGCATCGCCGCGGGCGACCTGTCAGGGAACGCAGCAGTAGCTGCCCACGGGGCCACTGTGCTTAAGAAGCTGGGTGAGCTGCTGAAAGCTAAAGGTGACCACGCTGCCATCAAGCTCCTGGCAACCACCCACGCCACCAAGCACAAGATTGCCCTCAACAACTTCATGCTCATCACTGAGATCATCTGCAACGTGATGGGTGAGGAGGCAGGGCTGGACGGGGCAGGACAGGAAGCTCTGAGGCAGGTGATGGGTGTGATCATAGCTGAAATCGATGTCACCTACAAGGAGCTGGGCTTTACTGGCTAAAGGGTTTACCTCAACGACGCTGGTTTGCTTGTGACTTCCAGAAAAACTTACTGGAAAAGTGTATGAGGCAAAGCATTTGTGCAAATTCTACATTTCTCTATACAGTATATTGCCTTAATCTGCCCTTTCAATGTAGTTTGCTTACTGAATGTGCGTTGTTCCTCTTTGCACTAAACCAATAAACGTTCCGTTAGCTGCAAA

Function


symbol description
mb Predicted to enable oxygen binding activity. Acts upstream of or within several processes, including response to activity; response to hypoxia; and vasculogenesis. Is expressed in several structures, including cardiovascular system; digestive system; epithelial cell; nervous system; and pharyngeal arch. Human ortholog(s) of this gene implicated in acute kidney failure. Orthologous to human MB (myoglobin).

NR:

description
myoglobin

GO:

id name namespace
GO:0015671 oxygen transport biological_process
GO:0005506 iron ion binding molecular_function
GO:0019825 oxygen binding molecular_function
GO:0005344 oxygen carrier activity molecular_function
GO:0020037 heme binding molecular_function

KEGG:

id description
K21892 MB; myoglobin

RNA


RNA id representative length rna type GC content exon number start site end site
NM_001171862.1 True 670 mRNA 0.51 4 21491234 21494421

Neighbor


gene id symbol gene type direction distance location
LOC110493454 NA coding downstream 26136 21463000 ~ 21465098 (-)
LOC110493440 LOC106564549 coding downstream 51747 21429348 ~ 21439487 (-)
LOC110493441 sox10 coding downstream 73804 21411626 ~ 21417430 (-)
LOC110493443 NA coding downstream 81987 21407072 ~ 21409247 (-)
LOC110493446 LOC106589449 coding downstream 105586 21377786 ~ 21385648 (-)
LOC110493463 LOC106588978 coding upstream 291745 21786166 ~ 21790195 (-)
trnaa-ugc-129 NA coding upstream 336469 21830890 ~ 21830965 (-)
LOC110493466 LOC103354157 coding upstream 356316 21850737 ~ 21851205 (-)
LOC110495103 LOC106598553 coding upstream 396260 21890681 ~ 21895100 (-)
LOC118940360 NA coding upstream 425213 21919634 ~ 21923538 (-)
G1427923 NA non-coding downstream 1201 21489810 ~ 21490033 (-)
G1427901 NA non-coding downstream 20191 21470665 ~ 21471043 (-)
G1427902 NA non-coding downstream 25134 21465618 ~ 21466100 (-)
G1427897 LOC106564544 non-coding downstream 30831 21460151 ~ 21460403 (-)
G1427904 NA non-coding upstream 4334 21498755 ~ 21499887 (-)
G1427900 NA non-coding upstream 34477 21528898 ~ 21529475 (-)
G1427950 NA non-coding upstream 44245 21538666 ~ 21538872 (-)
G1428165 NA non-coding upstream 142470 21636891 ~ 21638651 (-)
G1428230 LOC106589277 non-coding upstream 268780 21763201 ~ 21768179 (-)
G1427703 NA other downstream 479914 21007541 ~ 21032030 (-)
LOC110511666 LOC106589939 other downstream 703649 20785995 ~ 20787989 (-)
G1427608 NA other downstream 716859 20772526 ~ 20774375 (-)
G1427470 NA other downstream 934342 20553196 ~ 20556892 (-)
G1428161 LOC106564449 other upstream 132256 21626677 ~ 21627280 (-)
G1428291 LOC106588995 other upstream 309910 21804331 ~ 21804660 (-)
G1428740 NA other upstream 844958 22339379 ~ 22340563 (-)
G1429642 NA other upstream 1759901 23254322 ~ 23254592 (-)
G1429643 NA other upstream 1760472 23254893 ~ 23255180 (-)

Expression


mb(mb) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20000.
End of interactive chart.

mb(mb) Expression in each Bioproject

Bar chart with 14 bars.
mb(mb) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 80000.
End of interactive chart.

Co-expression Network