trnaa-ugc-129



Basic Information


Item Value
gene id trnaa-ugc-129
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 21830890 ~ 21830965 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>trnaa-ugc-129
ggtcccatgtggctcagttagtagagcatggagcttgcaacgccagggttgtgggttcgattcccacgggggacca

Function


NR:

description
Deoxyribonuclease gamma precursor

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
trnaa-ugc-129 True 76 mRNA 0.59 1 21830890 21830965
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110493463 LOC106588978 coding downstream 40695 21786166 ~ 21790195 (-)
mb mb coding downstream 336469 21491234 ~ 21494421 (-)
LOC110493454 NA coding downstream 365792 21463000 ~ 21465098 (-)
LOC110493440 LOC106564549 coding downstream 391403 21429348 ~ 21439487 (-)
LOC110493441 sox10 coding downstream 413460 21411626 ~ 21417430 (-)
LOC110493466 LOC103354157 coding upstream 19772 21850737 ~ 21851205 (-)
LOC110495103 LOC106598553 coding upstream 59716 21890681 ~ 21895100 (-)
LOC118940360 NA coding upstream 88669 21919634 ~ 21923538 (-)
LOC110511450 NA coding upstream 115050 21946015 ~ 21948796 (-)
LOC110493497 LOC106564611 coding upstream 193768 22024733 ~ 22048032 (-)
G1428293 NA non-coding downstream 23468 21807084 ~ 21807422 (-)
G1428290 NA non-coding downstream 26682 21804007 ~ 21804208 (-)
G1428285 LOC106588995 non-coding downstream 32404 21797941 ~ 21798486 (-)
G1428230 LOC106589277 non-coding downstream 62711 21763201 ~ 21768179 (-)
G1428165 NA non-coding downstream 192239 21636891 ~ 21638651 (-)
G1428323 NA non-coding upstream 37629 21868594 ~ 21870083 (-)
G1428366 NA non-coding upstream 127351 21958316 ~ 21960112 (-)
G1428564 LOC106588948 non-coding upstream 155136 21986101 ~ 21987434 (-)
G1428570 NA non-coding upstream 157105 21988070 ~ 21988784 (-)
G1428573 NA non-coding upstream 163495 21994460 ~ 21994703 (-)
G1428291 LOC106588995 other downstream 26230 21804331 ~ 21804660 (-)
G1428161 LOC106564449 other downstream 203610 21626677 ~ 21627280 (-)
LOC110493443 NA other downstream 421692 21407072 ~ 21409247 (-)
G1427703 NA other downstream 819570 21007541 ~ 21032030 (-)
LOC110511666 LOC106589939 other downstream 1043305 20785995 ~ 20787989 (-)
G1428740 NA other upstream 508414 22339379 ~ 22340563 (-)
G1429642 NA other upstream 1423357 23254322 ~ 23254592 (-)
G1429643 NA other upstream 1423928 23254893 ~ 23255180 (-)
LOC110493468 cnnm2 other upstream 1521533 23233049 ~ 23353185 (-)
LOC110495111 LOC106564590 other upstream 1573686 23403904 ~ 23410855 (-)

Expression


trnaa-ugc-129 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

trnaa-ugc-129 Expression in each Bioproject

Bar chart with 1 bar.
trnaa-ugc-129 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network