LOC118940117


Basic Information

Item Value
gene id LOC118940117
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 34814353 ~ 34815153 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>XM_036948373.1
ATGAAGGCTTCATCTAATTCACTGAGTACCGCTGTGCCCCCACTGCTGTTCCCCCACCGCTGTGCCCCCACTGCTGTTCCCCCACTGCTGTGCCCCCACTGCTGTTCCCCCACCGCTGTGCCCCCACTGCCGTGCCCCCACCGCTGTGCCCCCACCGCTGTTCCCCCACCGCTGTGCCCCCACTGCCGTGCCCCCACCGCTGTGCCCCCACCGCTGTGCCCCCACCGCTGTGCCCCCACTGCTCTGCCCCCACCTCTGTGCCCCCACCTCTGTGCCCCCACCGCTGTGCCACCACTGCTGTTCCCCCACCGCTGTTCCCCCACCGCTGTGCCCCCACCGCTGTGCCCCCACCTCTGTGCCCCCACCGCTGTGCCACCACTGCTGTTCCCCCACCGCTGTGCCCCCACTGCTCTGCCCCCACCTCTGTGCCCCCACCGCTGTGCCCCCACTGCTCTGCCCCCACCTCTGTGCCCCCACCTCTGTGCCCCCACCGCTGTGCCACCACTGCTGTTCCCCCACCGCTGTGCCACCACTGCTGTTCCCCCACCTCTGTGCCCCCACCGCTGTGCCCCCACTGCTCTGCCCCCACCTCTGTGCCCCCACCTCTGTGCCCCCACCGCTGTGCCCCCACTGCTCTGCCCCCACCTCTGTGCCCCCACCGCTGTGCCCCCACTGCTCTGCCCCCACCTCTGTGCCCCCACCTCTGTGCCCCCACCTCTGTGCCCCCACCGCTGTGCCCCCACCGCGGTGCCCCCACCAGTGTTCACTAATACAACCACCTTGGCACGCTCACAACTATAG

Function

NR:

description
uncharacterized protein LOC110503960

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
XM_036948373.1 True 801 mRNA 0.70 1 34814353 34815153
Loading

Neighbor

gene id symbol gene type direction distance location
gemin6 gemin6 coding downstream 25992 34785537 ~ 34788361 (-)
tmem178 LOC106564792 coding downstream 209283 34589353 ~ 34605070 (-)
LOC118940658 NA coding downstream 317684 34496620 ~ 34496669 (-)
pgap4 tmem246 coding downstream 363520 34446356 ~ 34468485 (-)
tpcn3 tpc1 coding downstream 383797 34413543 ~ 34430556 (-)
LOC110493798 if4a3 coding upstream 147611 34962764 ~ 34970771 (-)
LOC118940673 NA coding upstream 150113 34965266 ~ 34965392 (-)
LOC118940674 NA coding upstream 151056 34966209 ~ 34966342 (-)
LOC110493799 LOC106564784 coding upstream 163391 34976092 ~ 35008618 (-)
LOC118940098 NA coding upstream 198910 35014063 ~ 35019078 (-)
G1442347 NA non-coding downstream 37759 34736943 ~ 34776594 (-)
G1442372 LOC106564790 non-coding downstream 46114 34766558 ~ 34768239 (-)
G1442365 NA non-coding downstream 52399 34761190 ~ 34761954 (-)
G1442341 NA non-coding downstream 82566 34731470 ~ 34731787 (-)
G1442340 NA non-coding downstream 87403 34726332 ~ 34726950 (-)
G1442442 NA non-coding upstream 86735 34901888 ~ 34903193 (-)
G1442458 NA non-coding upstream 99813 34914966 ~ 34915185 (-)
G1442651 NA non-coding upstream 110395 34925548 ~ 34929740 (-)
G1442694 NA non-coding upstream 200035 35015188 ~ 35015396 (-)
G1442336 LOC106564790 other downstream 93561 34720427 ~ 34720792 (-)
G1442139 NA other downstream 453047 34360102 ~ 34361306 (-)
LOC110493763 LOC106564812 other downstream 1398000 33413110 ~ 33515866 (-)
G1440786 NA other downstream 1427825 33385937 ~ 33386528 (-)
G1440781 NA other downstream 1431634 33381901 ~ 33382719 (-)
G1442443 NA other upstream 88929 34904082 ~ 34904616 (-)
LOC110493800 LOC106564782 other upstream 245046 35023723 ~ 35061975 (-)
G1442932 rbbp9 other upstream 413601 35228754 ~ 35232154 (-)
LOC110495171 cssa12h2orf73 other upstream 800551 35615229 ~ 35617995 (-)
LOC110493173 slc29a1 other upstream 1164828 35979898 ~ 36012831 (-)

Expression

LOC118940117 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network