LOC118940130 (LOC106024139)


Basic Information

Item Value
gene id LOC118940130
gene name LOC106024139
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 36289124 ~ 36289747 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>XM_036948388.1
ATGGCAGAAGTCGCACCAGCACCCGCCGCCGCCGCGCCGGCCAAGGCACCCAAGAAGAAGGCAGCAGCCAAGCCCAAGAAAGCGGGACCCAGCGTAGGCGAGCTCATCGTCAAGGCGGTGTCCGCCTCCAAGGAGAGGAGCGGCGTGTCCCTGGCCGCGCTCAAGAAGTCTCTGGCGGCAGGCGGCTACGACGTGGAGAAGAACAACTCCCGTGTCAAGATCGCCGTCAAGAGCCTCGTCACCAAGGGCACCCTGGTCCAGACTAAGGGCACCGGTGCTTCCGGCTCCTTCAAGCTCAACAAGAAGGCCGTCGAGGCAAAGAAGCCCGCCAAGAAAGCCGCAGCCCCCAAAGCTAAGAAGGTGGCCGCCAAGAAGCCCGCCGCCGCCAAGAAGCCCAAGAAGGTAGCAGCCAAGAAGGCCGTGGCCGCAAAGAAGTCCCCCAAGAAGGCCAAGAAGCCCGCTACACCCAAAAAGGCCGCCAAGAGCCCAAAGAAGGTGAAGAAGCCCGCCGCAGCGGCCAAGAAAGCGGCCAAGAGCCCCAAGAAGGCTACCAAGGCAGCGAAGCCCAAAGCCGCCAAGCCCAAGGCGGCCAAGGCCAAGAAGGCAGCCCCCAAGAAGAAGTAA

Function

NR:

description
PREDICTED: histone H1-like

GO:

id name namespace
GO:0006334 nucleosome assembly biological_process
GO:0042742 defense response to bacterium biological_process
GO:0000786 nucleosome cellular_component
GO:0005576 extracellular region cellular_component
GO:0005634 nucleus cellular_component
GO:0003677 DNA binding molecular_function

KEGG:

id description
K11275 H1_5; histone H1/5

RNA

RNA id representative length rna type GC content exon number start site end site
XM_036948388.1 True 624 mRNA 0.63 1 36289124 36289747
Loading

Neighbor

gene id symbol gene type direction distance location
LOC118940129 LOC106906734 coding downstream 646 36288092 ~ 36288478 (-)
LOC118940419 LOC103395674 coding downstream 1383 36287181 ~ 36287741 (-)
LOC118940128 LOC106958509 coding downstream 4952 36283861 ~ 36284172 (-)
LOC118940127 LOC107745493 coding downstream 5873 36282877 ~ 36283251 (-)
LOC118940411 LOC108414267 coding downstream 8301 36278369 ~ 36280823 (-)
LOC118940131 LOC105896809 coding upstream 1319 36291066 ~ 36292349 (-)
LOC110493843 NA coding upstream 357980 36647727 ~ 36666627 (-)
dynlrb1 LOC106565026 coding upstream 391287 36681034 ~ 36686599 (-)
cpne1 LOC106565032 coding upstream 517400 36807147 ~ 36872385 (-)
LOC110493847 LOC106565031 coding upstream 567681 36857428 ~ 36872380 (-)
G1443825 NA non-coding downstream 46483 36242010 ~ 36242641 (-)
G1443824 NA non-coding downstream 50459 36237571 ~ 36238665 (-)
G1443823 NA non-coding downstream 51837 36234032 ~ 36237287 (-)
G1443832 NA non-coding downstream 63596 36224859 ~ 36225528 (-)
G1443827 NA non-coding downstream 102876 36185960 ~ 36186248 (-)
G1443836 NA non-coding upstream 9325 36299072 ~ 36299428 (-)
G1443839 NA non-coding upstream 10710 36300457 ~ 36301256 (-)
G1443840 NA non-coding upstream 11864 36301611 ~ 36301810 (-)
G1443921 NA non-coding upstream 97063 36386810 ~ 36455791 (-)
G1443979 NA non-coding upstream 176603 36466350 ~ 36466688 (-)
G1443821 NA other downstream 115073 36170870 ~ 36174051 (-)
LOC118940405 slc29a1 other downstream 174742 36087429 ~ 36123409 (-)
LOC110493173 slc29a1 other downstream 280736 35979898 ~ 36012831 (-)
LOC110495171 cssa12h2orf73 other downstream 671202 35615229 ~ 35617995 (-)
G1443835 NA other upstream 7185 36296932 ~ 36297265 (-)
G1444775 NA other upstream 879234 37153825 ~ 37170504 (-)
G1446798 NA other upstream 2559018 38848765 ~ 38849084 (-)
G1447184 NA other upstream 2664507 38954254 ~ 39011535 (-)

Expression

LOC118940130(LOC106024139) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network