LOC118940519



Basic Information


Item Value
gene id LOC118940519
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 59583904 ~ 59584045 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>XR_005037115.1
attctttcgcagaggcgatatcatagcctatgaagtccatctgaggcgtgattattgctggttgaaaacttaacccaataccccgcttgggatgacttgaaatatagtcagccttggcaatttttgatagtctcatgtgaga

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
XR_005037115.1 True 142 mRNA 0.42 1 59583904 59584045
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118940715 NA coding upstream 1132 59582631 ~ 59582772 (+)
LOC118940714 NA coding upstream 2405 59581358 ~ 59581499 (+)
LOC118940713 NA coding upstream 3678 59580085 ~ 59580226 (+)
LOC118940712 NA coding upstream 4951 59578812 ~ 59578953 (+)
LOC118940711 NA coding upstream 6224 59577539 ~ 59577680 (+)
LOC118940520 NA coding downstream 1132 59585177 ~ 59585318 (+)
LOC118940542 NA coding downstream 2405 59586450 ~ 59586591 (+)
LOC118940529 NA coding downstream 3678 59587723 ~ 59587864 (+)
LOC118940546 NA coding downstream 4951 59588996 ~ 59589137 (+)
LOC118940521 NA coding downstream 6224 59590269 ~ 59590410 (+)
G1470290 NA non-coding upstream 77567 59506034 ~ 59506337 (+)
G1470277 NA non-coding upstream 87778 59495827 ~ 59496126 (+)
G1469990 NA non-coding upstream 132722 59450762 ~ 59451182 (+)
G1469871 NA non-coding upstream 178111 59405174 ~ 59405793 (+)
LOC110494244 NA non-coding upstream 319375 59258342 ~ 59266492 (+)
LOC118940527 NA non-coding downstream 28811 59612856 ~ 59613886 (+)
G1470301 NA non-coding downstream 30020 59614065 ~ 59618582 (+)
G1470331 NA non-coding downstream 55161 59639206 ~ 59639439 (+)
G1470335 NA non-coding downstream 59190 59643235 ~ 59643831 (+)
G1470341 NA non-coding downstream 63695 59647740 ~ 59647996 (+)
G1469076 NA other upstream 1076019 58507297 ~ 58507885 (+)
G1467219 NA other upstream 1969604 57589865 ~ 57614300 (+)
LOC110494206 LOC108254821 other upstream 2035726 57498305 ~ 57548178 (+)
G1467159 LOC106565433 other upstream 2100315 57478797 ~ 57554480 (+)
G1467031 NA other upstream 2433561 57149303 ~ 57150343 (+)
G1470607 NA other downstream 517847 60101892 ~ 60104007 (+)
G1471723 LOC100380707 other downstream 1388433 60972478 ~ 60999063 (+)
LOC110494283 LOC106565563 other downstream 1972274 61555873 ~ 61558328 (+)
G1473171 LOC106581772 other downstream 3114458 62698503 ~ 62698815 (+)
G1473177 NA other downstream 3126294 62710339 ~ 62711136 (+)

Expression


LOC118940519 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network