G1412999



Basic Information


Item Value
gene id G1412999
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 1268203 ~ 1268914 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1614946
tctctgtggtttctactctctctctctctctctctctgtagtctcttctctctctctctctctctctctctgtagtctcttctctctctctctctctgtagtctctctctctctctctctctctctctgtagtatctactctctctctgtctctctctctctctgtagtctcttctctctctctctctctctctctctctctctctgtagtctctctctctctctctgtagtctctactctctctctcgctttctctgtagtctctactctgtctctctctctctctgtagtctctactctctctctctctctctctctgtagtctctactctctctctctctctctctgtagtctctactctgtctctctctctctctgtagtctctac

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1614946 True 390 lncRNA 0.47 2 1268203 1268914
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110494868 LOC106564131 coding upstream 18970 1219631 ~ 1249233 (+)
LOC110493374 LOC106595501 coding upstream 59045 1177802 ~ 1209158 (+)
LOC110515042 LOC106564127 coding upstream 94219 1166086 ~ 1173984 (+)
LOC110516881 LOC106595542 coding upstream 109556 1142087 ~ 1158647 (+)
LOC110485352 LOC106594003 coding upstream 193087 1069986 ~ 1075471 (+)
LOC118940052 LOC106595394 coding downstream 56031 1324945 ~ 1343422 (+)
LOC110517405 LOC106595394 coding downstream 74439 1343353 ~ 1361846 (+)
LOC110513275 ears2 coding downstream 297781 1566695 ~ 1581725 (+)
LOC110493339 LOC106564102 coding downstream 314484 1583398 ~ 1609136 (+)
LOC118940181 NA coding downstream 483139 1752053 ~ 1755213 (+)
G1412989 NA non-coding upstream 28910 1237967 ~ 1239293 (+)
G1412965 NA non-coding upstream 63421 1204524 ~ 1204782 (+)
G1412964 NA non-coding upstream 78222 1189201 ~ 1189981 (+)
G1412954 NA non-coding upstream 110765 1157172 ~ 1157438 (+)
G1413003 NA non-coding downstream 36263 1305177 ~ 1305762 (+)
G1413005 NA non-coding downstream 45679 1314593 ~ 1314819 (+)
G1412970 NA non-coding downstream 53033 1321947 ~ 1322859 (+)
G1413010 NA non-coding downstream 62573 1331487 ~ 1332381 (+)
G1413022 NA non-coding downstream 124358 1393272 ~ 1393761 (+)
G1412947 LOC106596877 other upstream 127894 1139800 ~ 1140309 (+)
G1412926 NA other upstream 169589 1098246 ~ 1098614 (+)
LOC110485351 LOC106593629 other upstream 218283 1047782 ~ 1053488 (+)
G1412853 NA other upstream 272914 994716 ~ 995289 (+)
G1413121 LOC106595424 other downstream 388247 1657161 ~ 1679798 (+)
LOC110493359 LOC106564044 other downstream 922090 2191004 ~ 2199748 (+)
LOC110514702 LOC106603759 other downstream 936092 2204951 ~ 2277856 (+)
G1414065 NA other downstream 1393256 2662170 ~ 2690141 (+)

Expression


G1412999 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

G1412999 Expression in each Bioproject

Bar chart with 18 bars.
G1412999 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 15.
End of interactive chart.

Co-expression Network