G1413691



Basic Information


Item Value
gene id G1413691
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 2043543 ~ 2043792 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1615956
tttccactagatgttggaacattgctgctataacagcctccactcttctgggaaggctttccactagatgttggaacattgctgctataacagcctccactcttcagggaaggctttccactagatgttggaacattgctgctataacagcctccactcttcagggaaggctttccactagatgatggaacattgctgctataacagcctccactcttcagggaaggctttccactagatgatggaacat

Function


NR:

description
unnamed protein product

GO: NA

KEGG:

id description

RNA


RNA id representative length rna type GC content exon number start site end site
TU1615956 True 250 lncRNA 0.46 1 2043543 2043792
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110495385 LOC106564038 coding downstream 4949 2028927 ~ 2038594 (-)
LOC110487164 LOC106594397 coding downstream 131678 1856938 ~ 1911865 (-)
LOC110487311 LOC106594864 coding downstream 151180 1832683 ~ 1892363 (-)
LOC110495008 LOC106594873 coding downstream 190053 1844263 ~ 1853490 (-)
LOC118940180 LOC106594902 coding downstream 216051 1821660 ~ 1827492 (-)
LOC110495386 LOC106564079 coding upstream 285 2044077 ~ 2048762 (-)
LOC110493355 NA coding upstream 12618 2056410 ~ 2062833 (-)
LOC110495011 NA coding upstream 23111 2066903 ~ 2072186 (-)
LOC110493350 LOC106564047 coding upstream 30364 2074156 ~ 2087148 (-)
LOC110493352 LOC106591818 coding upstream 47681 2091473 ~ 2097299 (-)
G1413686 NA non-coding downstream 9500 2032974 ~ 2034043 (-)
G1413684 NA non-coding downstream 12320 2030994 ~ 2031223 (-)
G1413672 NA non-coding downstream 14637 2028496 ~ 2028906 (-)
G1413683 NA non-coding downstream 15766 2027552 ~ 2027777 (-)
G1413785 NA non-coding upstream 45528 2089320 ~ 2090157 (-)
LOC110487162 LOC106590947 non-coding upstream 132997 2176789 ~ 2186737 (-)
G1413906 NA non-coding upstream 146160 2189952 ~ 2190216 (-)
G1413907 NA non-coding upstream 147284 2191076 ~ 2234168 (-)
G1413673 NA other downstream 32184 2009680 ~ 2011972 (-)
G1413583 NA other downstream 177904 1865005 ~ 1865639 (-)
LOC110515431 LOC106594722 other downstream 299055 1740494 ~ 1752575 (-)
G1413766 LOC106564079 other upstream 788 2044580 ~ 2061694 (-)
LOC110511869 LOC105029636 other upstream 362139 2404432 ~ 2494634 (-)
LOC118940184 LOC106591209 other upstream 580192 2555143 ~ 2642537 (-)
LOC110516499 LOC106563979 other upstream 671445 2713556 ~ 2723485 (-)
LOC110516478 LOC106564555 other upstream 739533 2782336 ~ 2792008 (-)

Expression


G1413691 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 60.
End of interactive chart.

G1413691 Expression in each Bioproject

Bar chart with 19 bars.
G1413691 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 750.
End of interactive chart.

Co-expression Network