G1414971



Basic Information


Item Value
gene id G1414971
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 2613797 ~ 2614234 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1617696
tatatatatataacctggtagtgtatatataacctggtagtgtatatatataacctggtagtgtatatatataacctggtagtgtatatatataacctggtagtgtatatatataacctggtagtgtatatacagtgccttgcgaaagtattcggcccccttgaactttgcgaacttttgccacatttcaggcttcaaacataaagatataaaactgtatttttttgtgaagaatcaacaacaagtgggac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1617696 True 251 lncRNA 0.33 2 2613797 2614234
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110511869 LOC105029636 coding downstream 119163 2404432 ~ 2494634 (-)
LOC118940186 LOC106612417 coding downstream 263509 2330274 ~ 2350288 (-)
LOC118940185 LOC106612417 coding downstream 305279 2301269 ~ 2308518 (-)
LOC110487162 LOC106590947 coding downstream 427060 2176789 ~ 2186737 (-)
LOC118940183 LOC106564048 coding downstream 440313 2168762 ~ 2173484 (-)
LOC110515691 NA coding upstream 66441 2680675 ~ 2690430 (-)
LOC110514117 LOC106593138 coding upstream 84361 2698595 ~ 2707054 (-)
LOC118940053 NA coding upstream 98396 2712630 ~ 2713738 (-)
LOC110516499 LOC106563979 coding upstream 99322 2713556 ~ 2723485 (-)
LOC110511979 LOC106594716 coding upstream 126861 2741095 ~ 2773447 (-)
G1414956 NA non-coding downstream 91948 2521335 ~ 2521849 (-)
G1414948 NA non-coding downstream 106029 2506348 ~ 2507768 (-)
G1414944 NA non-coding downstream 112796 2499611 ~ 2501001 (-)
G1414938 NA non-coding downstream 123403 2489912 ~ 2490394 (-)
G1414914 NA non-coding downstream 203080 2409800 ~ 2410717 (-)
G1414972 NA non-coding upstream 2088 2616322 ~ 2616559 (-)
LOC118940184 LOC106591209 non-coding upstream 20211 2555143 ~ 2642537 (-)
G1414975 NA non-coding upstream 34686 2648920 ~ 2654107 (-)
G1415049 NA non-coding upstream 145770 2760004 ~ 2808498 (-)
G1413766 LOC106564079 other downstream 552103 2044580 ~ 2061694 (-)
LOC110495385 LOC106564038 other downstream 575477 2028927 ~ 2038594 (-)
G1413673 NA other downstream 602438 2009680 ~ 2011972 (-)
G1413583 NA other downstream 748158 1865005 ~ 1865639 (-)
LOC110516478 LOC106564555 other upstream 169091 2782336 ~ 2792008 (-)
LOC118936352 LOC106593206 other upstream 188910 2801377 ~ 2810350 (-)
LOC110519887 NA other upstream 494916 3107213 ~ 3113094 (-)

Expression


G1414971 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G1414971 Expression in each Bioproject

Bar chart with 15 bars.
G1414971 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 250.
End of interactive chart.

Co-expression Network