G1417908



Basic Information


Item Value
gene id G1417908
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 8268856 ~ 8269201 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1621814
gatggcaacacccatccgtagcacgcgctccagcaggtgtatctcactgatcatccctaaagccaacacctcatttgtccgcctttcgttccagttctctgctgcctgtgactggaacgaattgcaaaaatcgctgaagttggagacttttatctccctcaccaacttcaaacatctgctatctgagcagctaaccgatcgctgcagctatacatagtctattggtaaatagcccacccattttcacctacctcatccccatactgtttttatttatttatttttctgctcttttgcacaccaatatctctacctgtacataaccatctgatcatttatcactcca

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1621814 True 346 lncRNA 0.44 1 8268856 8269201
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118940075 LOC106564154 coding upstream 18419 8246687 ~ 8250437 (+)
LOC118940250 LOC106564141 coding upstream 127594 8070985 ~ 8141262 (+)
LOC118936549 LOC106590476 coding upstream 198011 8048682 ~ 8070845 (+)
LOC110513544 LOC106564138 coding upstream 412110 7683702 ~ 7856746 (+)
LOC110487504 LOC106593600 coding upstream 669235 7566150 ~ 7599621 (+)
LOC110499479 ubl5 coding downstream 115180 8384381 ~ 8392496 (+)
LOC110516831 LOC106593980 coding downstream 182898 8452099 ~ 8491706 (+)
LOC118940253 NA coding downstream 218446 8487647 ~ 8488586 (+)
LOC110485368 LOC105027472 coding downstream 501368 8761682 ~ 8790721 (+)
LOC110494882 LOC106593417 coding downstream 521997 8791198 ~ 8807660 (+)
G1417898 NA non-coding upstream 5992 8256492 ~ 8262864 (+)
G1417880 NA non-coding upstream 44835 8222917 ~ 8224021 (+)
G1417681 NA non-coding upstream 64672 8203862 ~ 8204184 (+)
G1417663 NA non-coding upstream 112438 8155264 ~ 8156418 (+)
G1417935 NA non-coding downstream 28335 8297536 ~ 8376139 (+)
G1417939 NA non-coding downstream 44540 8313741 ~ 8314434 (+)
G1417950 NA non-coding downstream 67390 8336591 ~ 8339117 (+)
G1417960 NA non-coding downstream 79466 8348667 ~ 8349349 (+)
G1417925 NA non-coding downstream 101993 8371194 ~ 8371745 (+)
G1417682 NA other upstream 63945 8204401 ~ 8204911 (+)
G1417618 NA other upstream 133430 8133184 ~ 8135426 (+)
G1417561 NA other upstream 433267 7835102 ~ 7835589 (+)
G1417938 NA other downstream 100640 8369841 ~ 8370510 (+)
G1418037 LOC106594248 other downstream 309404 8578605 ~ 8581151 (+)

Expression


G1417908 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G1417908 Expression in each Bioproject

Bar chart with 17 bars.
G1417908 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network