G1417950



Basic Information


Item Value
gene id G1417950
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 8336591 ~ 8339117 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1621862
ctaacatcaccatccagtaggttctacatcactaatatcaccatccagtaggttctacatcactaatatcaccatccagtaggttctacatcactacactaatatcaccatccagtaggttctacatcactaatatcaccatccagtaggttctacatcactaatatcaccatccagtaggttctacatcactaatatcaccatccagtaggttatacatcactaat

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1621862 True 227 lncRNA 0.38 2 8336591 8339117
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118940075 LOC106564154 coding upstream 86154 8246687 ~ 8250437 (+)
LOC118940250 LOC106564141 coding upstream 195329 8070985 ~ 8141262 (+)
LOC118936549 LOC106590476 coding upstream 265746 8048682 ~ 8070845 (+)
LOC110513544 LOC106564138 coding upstream 479845 7683702 ~ 7856746 (+)
LOC110487504 LOC106593600 coding upstream 736970 7566150 ~ 7599621 (+)
LOC110499479 ubl5 coding downstream 45264 8384381 ~ 8392496 (+)
LOC110516831 LOC106593980 coding downstream 112982 8452099 ~ 8491706 (+)
LOC118940253 NA coding downstream 148530 8487647 ~ 8488586 (+)
LOC110485368 LOC105027472 coding downstream 431452 8761682 ~ 8790721 (+)
LOC110494882 LOC106593417 coding downstream 452081 8791198 ~ 8807660 (+)
G1417939 NA non-coding upstream 22157 8313741 ~ 8314434 (+)
G1417908 NA non-coding upstream 67390 8268856 ~ 8269201 (+)
G1417898 NA non-coding upstream 73727 8256492 ~ 8262864 (+)
G1417880 NA non-coding upstream 112570 8222917 ~ 8224021 (+)
G1417681 NA non-coding upstream 132407 8203862 ~ 8204184 (+)
G1417960 NA non-coding downstream 9550 8348667 ~ 8349349 (+)
G1417925 NA non-coding downstream 32077 8371194 ~ 8371745 (+)
G1417930 NA non-coding downstream 55245 8394362 ~ 8395185 (+)
G1417928 NA non-coding downstream 56339 8395456 ~ 8395878 (+)
G1417926 NA non-coding downstream 56853 8395970 ~ 8396460 (+)
G1417682 NA other upstream 131680 8204401 ~ 8204911 (+)
G1417618 NA other upstream 201165 8133184 ~ 8135426 (+)
G1417561 NA other upstream 501002 7835102 ~ 7835589 (+)
G1417938 NA other downstream 30724 8369841 ~ 8370510 (+)
G1418037 LOC106594248 other downstream 239488 8578605 ~ 8581151 (+)

Expression


G1417950 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 50.
End of interactive chart.

G1417950 Expression in each Bioproject

Bar chart with 7 bars.
G1417950 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 800.
End of interactive chart.

Co-expression Network