G1419896



Basic Information


Item Value
gene id G1419896
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 10841491 ~ 10841791 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1624586
ctgagtcttgtcatctcataagaactaaagctctgtactgagtcttgtcctctcataagaactaaagctctgaactgagtctttttaactcataagaactaaaagctctgtactgagtcttgtcctctcataagaactaaagctctgtactgagtcttgtcctctcataagaactaaagctctgaactgagtctttttaactcataagaactaaaagctctttactgagtcttgtcctctcataagaactaaaagctctgtactgagtcttgtcctctcataagaactaaaagctctgtac

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1624586 True 301 lncRNA 0.38 1 10841491 10841791

Neighbor


gene id symbol gene type direction distance location
LOC118940261 LOC106564223 coding downstream 119633 10706916 ~ 10721858 (-)
LOC110510716 LOC106592827 coding downstream 581486 10221765 ~ 10260005 (-)
LOC118940262 NA coding downstream 621502 10216748 ~ 10219989 (-)
LOC110511093 LOC106592827 coding downstream 658147 10136904 ~ 10183344 (-)
LOC118940263 LOC106592855 coding downstream 708816 10130894 ~ 10132675 (-)
LOC118940264 LOC106592432 coding upstream 49219 10891010 ~ 10905069 (-)
LOC118940077 LOC106564215 coding upstream 94244 10936035 ~ 10952431 (-)
LOC110510799 LOC106564209 coding upstream 168326 10999788 ~ 11068307 (-)
LOC118940266 LOC106592549 coding upstream 253742 11095533 ~ 11111355 (-)
LOC118940265 b3gntl1 coding upstream 279433 11121224 ~ 11170715 (-)
G1419895 NA non-coding downstream 2603 10838597 ~ 10838888 (-)
G1419887 NA non-coding downstream 12691 10827476 ~ 10828800 (-)
G1419878 NA non-coding downstream 26201 10814755 ~ 10815290 (-)
G1419704 NA non-coding downstream 66363 10774868 ~ 10775128 (-)
G1419702 NA non-coding downstream 66753 10773697 ~ 10774738 (-)
G1419898 NA non-coding upstream 22565 10864356 ~ 10864594 (-)
G1419899 NA non-coding upstream 24364 10866155 ~ 10869493 (-)
G1419901 NA non-coding upstream 28226 10870017 ~ 10870273 (-)
G1419911 LOC106592948 non-coding upstream 39664 10881455 ~ 10883758 (-)
G1419910 NA non-coding upstream 42725 10884516 ~ 10886230 (-)
G1419709 NA other downstream 67865 10382157 ~ 10773626 (-)
G1419810 NA other downstream 147178 10621271 ~ 10694313 (-)
G1419766 LOC106566240 other downstream 167984 10543428 ~ 10673507 (-)
G1419772 LOC106592307 other downstream 327619 10513380 ~ 10513872 (-)
G1419692 NA other downstream 400245 10363171 ~ 10441246 (-)
G1420025 NA other upstream 365904 11207695 ~ 11208806 (-)
G1420640 NA other upstream 1038007 11879798 ~ 11882819 (-)
G1420677 NA other upstream 1181923 12023714 ~ 12024024 (-)

Expression


G1419896 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G1419896 Expression in each Bioproject

Bar chart with 2 bars.
G1419896 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 50.
End of interactive chart.

Co-expression Network