G1420415



Basic Information


Item Value
gene id G1420415
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 11301850 ~ 11303073 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1625272
ggttagtatggttgttatggacaggttagtatggttgttatggacaggttagtatggttgttatccaggacaggttagtatggttgttatccaggacaggttagtatggttgttatccaggacaggttagtatggttgttatggacaggttagtatggttgttatccaggacaggttagtatggttgttatggacaggttagtatggttgttatggacaggttagtatggttgttatccaggacaggttagtatggttgttatccaggacaggttagtatggttgttatccaggacaggttagtatggttgttatccaggacaggttagtatggttgttatccaggacaggttagtatggttgttatccaggacaggttagtatggttgttatccaggac

Function


NR:

description
PREDICTED: potassium voltage-gated channel subfamily V member 1 isoform X4

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1625272 True 400 lncRNA 0.42 2 11301850 11303073
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118940267 mycbpap coding downstream 10288 11238688 ~ 11291562 (-)
LOC118940269 LOC106596101 coding downstream 63248 11212199 ~ 11238602 (-)
LOC118940265 b3gntl1 coding downstream 131135 11121224 ~ 11170715 (-)
LOC118940266 LOC106592549 coding downstream 190495 11095533 ~ 11111355 (-)
LOC110510799 LOC106564209 coding downstream 233543 10999788 ~ 11068307 (-)
LOC118940273 NA coding upstream 261170 11564243 ~ 11566831 (-)
LOC110485436 LOC106592457 coding upstream 264690 11567763 ~ 11577945 (-)
LOC110485438 NA coding upstream 297835 11600908 ~ 11609461 (-)
LOC118940276 NA coding upstream 342278 11645351 ~ 11646116 (-)
LOC110493402 NA coding upstream 533948 11837021 ~ 11842259 (-)
G1420414 NA non-coding downstream 179 11301371 ~ 11301671 (-)
G1420413 NA non-coding downstream 2176 11299392 ~ 11299674 (-)
G1420412 NA non-coding downstream 3783 11296666 ~ 11298067 (-)
G1420056 NA non-coding downstream 13782 11287650 ~ 11288068 (-)
G1420047 NA non-coding downstream 49256 11252094 ~ 11252594 (-)
G1420422 NA non-coding upstream 2148 11305221 ~ 11311619 (-)
G1420419 LOC106597237 non-coding upstream 19898 11322971 ~ 11535358 (-)
G1420441 NA non-coding upstream 51322 11354395 ~ 11355471 (-)
G1420427 NA non-coding upstream 127810 11430883 ~ 11505847 (-)
G1420498 NA non-coding upstream 192987 11496060 ~ 11540704 (-)
G1420025 NA other downstream 93044 11207695 ~ 11208806 (-)
LOC118940264 LOC106592432 other downstream 404333 10891010 ~ 10905069 (-)
G1419810 NA other downstream 607537 10621271 ~ 10694313 (-)
G1419766 LOC106566240 other downstream 628343 10543428 ~ 10673507 (-)
G1420640 NA other upstream 576725 11879798 ~ 11882819 (-)
G1420677 NA other upstream 720641 12023714 ~ 12024024 (-)
G1420686 NA other upstream 750747 12053820 ~ 12054208 (-)
LOC110487206 LOC106606788 other upstream 758288 12056279 ~ 12072151 (-)
LOC118940282 LOC106593131 other upstream 954485 12184586 ~ 12271974 (-)

Expression


G1420415 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G1420415 Expression in each Bioproject

Bar chart with 14 bars.
G1420415 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network