G1427350 (LOC106589837)



Basic Information


Item Value
gene id G1427350
gene name LOC106589837
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 20249795 ~ 20250083 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1634209
CAGAAACAACACATAACAATTCAGCATAGTTACCTGCAGGTATGATGACAGATAGGGCTGTGGCCGAGGCTGACTTGATAACCTTGTTGCCAGGCCGTGAGTTCCTCTTCTCCCCTGTGTCTCCAGACATCTGCTGGTGTCTCGCCCTGCGGAGGACCAGGTCATTCGTGGCCCGGGGGCCCAGGGGGTCATACACAGGTCCTGCCCCCAGCTCCCTATTGGCTGATGTAGGTCCAGGAGTAGTGGATGGAGTGGGCGTGGCTCCCAGAGACTTGCCTGGGCTTGGTGG

Function


NR:

description
microtubule-associated serine/threonine-protein kinase 1-like, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1634209 True 289 TUCP 0.58 1 20249795 20250083
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110487268 NA coding downstream 139466 20080254 ~ 20110329 (-)
LOC110485621 NA coding downstream 228694 20019616 ~ 20021101 (-)
LOC110487230 LOC106590349 coding downstream 668768 19540854 ~ 19581027 (-)
LOC110485541 xpnpep1 coding downstream 710107 19524837 ~ 19539688 (-)
LOC110485531 LOC106564462 coding downstream 748378 19500224 ~ 19501417 (-)
LOC110485337 LOC106590256 coding upstream 132135 20382218 ~ 20391692 (-)
keap1b LOC106564503 coding upstream 143030 20393113 ~ 20413872 (-)
LOC110493429 LOC106564504 coding upstream 173614 20423697 ~ 20429216 (-)
LOC118940353 LOC106590316 coding upstream 287330 20537413 ~ 20542283 (-)
LOC110485519 LOC106590222 coding upstream 297754 20547837 ~ 20550089 (-)
G1427349 LOC106589837 non-coding downstream 203 20249298 ~ 20249592 (-)
G1427348 NA non-coding downstream 887 20248608 ~ 20248908 (-)
G1427342 NA non-coding downstream 2164 20247149 ~ 20247631 (-)
G1427340 NA non-coding downstream 5068 20244412 ~ 20244727 (-)
G1427337 NA non-coding downstream 8751 20240822 ~ 20241044 (-)
G1427351 NA non-coding upstream 322 20250405 ~ 20250636 (-)
G1427302 NA non-coding upstream 6657 20256740 ~ 20257480 (-)
G1427301 NA non-coding upstream 7552 20257635 ~ 20258635 (-)
G1427359 NA non-coding upstream 17268 20267351 ~ 20267741 (-)
G1427347 NA non-coding upstream 20742 20270825 ~ 20272023 (-)
G1426626 LOC106590134 other downstream 186177 20061680 ~ 20063618 (-)
G1426547 NA other downstream 388132 19860301 ~ 19861663 (-)
G1426504 NA other downstream 446231 19799637 ~ 19803564 (-)
G1425986 NA other downstream 1077118 19169380 ~ 19172677 (-)
G1427470 NA other upstream 303113 20553196 ~ 20556892 (-)
G1427608 NA other upstream 522443 20772526 ~ 20774375 (-)
LOC110511666 LOC106589939 other upstream 535912 20785995 ~ 20787989 (-)
G1427703 NA other upstream 757458 21007541 ~ 21032030 (-)

Expression


G1427350(LOC106589837) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.8.
End of interactive chart.

G1427350(LOC106589837) Expression in each Bioproject

Bar chart with 4 bars.
G1427350(LOC106589837) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 4.
End of interactive chart.

Co-expression Network