G1427608



Basic Information


Item Value
gene id G1427608
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 20772526 ~ 20774375 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1634550
gccctctctcctaccctcctgcctctcctctcctctgatgtctcctctccactggtgtctcctctcctccggtgtctctcctctcctcccgtgtctctcctctcctgtgtctctcctttcctgtgtctctcctttcctgtgtctctcctctcctcctgtgtctctcctttcctcctgtgtctctcctctcctcctgtgtctctcctctcctccggtgtctctcctctcctcctgtgtctctcctttcctgtgtctctcctctcctcctgtgtctctcctctcctcctgtgtctctcctctcctcctgtgtctctcctctcctcctgtgtctctcctctcctcctgtgtctctcctctcctcatgtctcttctcctcctgtgtctctcctctcctcctgtgtctctcctctcctccggtgtctctcctctcctcctgtgtctctcctctcctccggtgtctctcctcctgtgtctctcctctcctcctgtgtctctcctctcctcctgtgtctctcctctcctcctgtgtctctcctc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1634550 True 537 TUCP 0.58 2 20772526 20774375
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110485646 LOC106589946 coding downstream 40559 20512356 ~ 20731967 (-)
LOC110485645 LOC106590024 coding downstream 201452 20567409 ~ 20571074 (-)
LOC110485519 LOC106590222 coding downstream 222437 20547837 ~ 20550089 (-)
LOC118940353 LOC106590316 coding downstream 230243 20537413 ~ 20542283 (-)
LOC110493429 LOC106564504 coding downstream 343310 20423697 ~ 20429216 (-)
LOC110511666 LOC106589939 coding upstream 12088 20785995 ~ 20787989 (-)
LOC110519576 LOC106589920 coding upstream 14091 20788466 ~ 20795116 (-)
LOC110485651 LOC106589910 coding upstream 22970 20797345 ~ 20804443 (-)
LOC110485654 rab3d coding upstream 32722 20807097 ~ 20825381 (-)
LOC110487512 LOC106589682 coding upstream 51672 20826047 ~ 20832359 (-)
G1427605 NA non-coding downstream 2481 20769280 ~ 20770045 (-)
G1427504 NA non-coding downstream 92573 20678823 ~ 20679953 (-)
G1427538 NA non-coding downstream 144943 20625634 ~ 20627583 (-)
G1427537 NA non-coding downstream 151014 20620540 ~ 20621512 (-)
G1427505 NA non-coding upstream 7144 20781519 ~ 20781824 (-)
G1427622 NA non-coding upstream 59330 20833705 ~ 20834221 (-)
G1427621 NA non-coding upstream 66694 20841069 ~ 20842443 (-)
G1427643 NA non-coding upstream 72457 20846832 ~ 20847397 (-)
G1427636 NA non-coding upstream 78470 20852845 ~ 20854524 (-)
G1427470 NA other downstream 215634 20553196 ~ 20556892 (-)
G1427350 LOC106589837 other downstream 522443 20249795 ~ 20250083 (-)
G1426626 LOC106590134 other downstream 708908 20061680 ~ 20063618 (-)
LOC110485621 NA other downstream 751468 20019616 ~ 20021101 (-)
G1427703 NA other upstream 233166 21007541 ~ 21032030 (-)
LOC110493443 NA other upstream 632707 21407072 ~ 21409247 (-)
G1428161 LOC106564449 other upstream 852302 21626677 ~ 21627280 (-)
G1428291 LOC106588995 other upstream 1029956 21804331 ~ 21804660 (-)

Expression


G1427608 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G1427608 Expression in each Bioproject

Bar chart with 9 bars.
G1427608 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network