G1427894



Basic Information


Item Value
gene id G1427894
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 21450974 ~ 21451202 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1634904
TCTCTGGCCCCGTCACACAGCACCCTGCTGGGGTACTAGAGCCACTCCTCCCTGGGTCTGGCAGGAAGTCCCACGGGTCCTCCTGACTGCTGGGTGAAGATATAGAGGGAGGGCATGAGGGACATTGGTAGTGGTACACACTCTATGAGTTTGGCACAATGTACTGTAGAACTAGTTGAAGAGAAATCACTACCTGATTGTAGAATTTCATTCAAATATAATGTTATCT

Function


NR:

description
PREDICTED: PH domain-containing protein DDB_G0275795-like, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1634904 True 229 lncRNA 0.49 1 21450974 21451202

Neighbor


gene id symbol gene type direction distance location
LOC110493440 LOC106564549 coding downstream 11487 21429348 ~ 21439487 (-)
LOC110493441 sox10 coding downstream 33544 21411626 ~ 21417430 (-)
LOC110493443 NA coding downstream 41727 21407072 ~ 21409247 (-)
LOC110493446 LOC106589449 coding downstream 65326 21377786 ~ 21385648 (-)
ntan1 ntan1 coding downstream 83596 21364150 ~ 21367378 (-)
LOC110493454 NA coding upstream 11798 21463000 ~ 21465098 (-)
mb mb coding upstream 40032 21491234 ~ 21494421 (-)
LOC110493463 LOC106588978 coding upstream 334964 21786166 ~ 21790195 (-)
trnaa-ugc-129 NA coding upstream 379688 21830890 ~ 21830965 (-)
LOC110493466 LOC103354157 coding upstream 399535 21850737 ~ 21851205 (-)
G1427889 NA non-coding downstream 6143 21444543 ~ 21444831 (-)
G1427883 NA non-coding downstream 21806 21428371 ~ 21429168 (-)
G1427880 NA non-coding downstream 26883 21423612 ~ 21424091 (-)
G1427879 NA non-coding downstream 27384 21422665 ~ 21423590 (-)
G1427871 NA non-coding downstream 50924 21399687 ~ 21400050 (-)
G1427896 triobp non-coding upstream 8169 21459371 ~ 21459944 (-)
G1427897 LOC106564544 non-coding upstream 8949 21460151 ~ 21460403 (-)
G1427902 NA non-coding upstream 14416 21465618 ~ 21466100 (-)
G1427901 NA non-coding upstream 19463 21470665 ~ 21471043 (-)
G1427703 NA other downstream 439654 21007541 ~ 21032030 (-)
LOC110511666 LOC106589939 other downstream 663389 20785995 ~ 20787989 (-)
G1427608 NA other downstream 676599 20772526 ~ 20774375 (-)
G1427470 NA other downstream 894082 20553196 ~ 20556892 (-)
G1428161 LOC106564449 other upstream 175475 21626677 ~ 21627280 (-)
G1428291 LOC106588995 other upstream 353129 21804331 ~ 21804660 (-)
G1428740 NA other upstream 888177 22339379 ~ 22340563 (-)
G1429642 NA other upstream 1803120 23254322 ~ 23254592 (-)
G1429643 NA other upstream 1803691 23254893 ~ 23255180 (-)

Expression


G1427894 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1427894 Expression in each Bioproject

Bar chart with 3 bars.
G1427894 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 10.
End of interactive chart.

Co-expression Network